Pholisora clytius Godman & Salvin, 1897
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BF5-7283-FE8D-F882ABF2FA88 |
treatment provided by |
Felipe |
scientific name |
Pholisora clytius Godman & Salvin, 1897 |
status |
|
Lectotype designations for Pholisora clytius Godman & Salvin, 1897 View in CoL and Bolla semitincta Dyar, 1924
Recently, we proposed that the genus Clytius Grishin, 2019 (type species Pholisora clytius Godman & Salvin, 1897 ) consists of five species: Clytius clytius (Godman & Salvin, 1897) (type locality in Mexico:
Nayarit, Tres Marias Island, syntype sequenced as NVG-18082E10), Clytius semitincta (Dyar, 1924)
(type locality in Colima, syntypes sequenced as ♂ NVG-15109B06 and ♀ NVG-15109C12), Clytius mattus Grishin, 2024 (type locality USA: Hidalgo Co., Bentsen-Rio Grande Valley State Park, holotype sequenced as NVG-5486), Clytius unifascia (Mabille, 1889) (type locality Honduras, lectotype sequenced as NVG-15033G05), and Clytius shola (Evans, 1953) (type locality not specified, likely in Venezuela) (Zhang et al. 2022b; Zhang et al. 2024b).
To stabilize nomenclature and define the name C. clytius objectively, N.V.G. hereby designates a syntype in the BMNH collection, a male that bears the following twelve labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; 7th, 9th, and 12th handwritten, others printed): (Type), (Type) and on the other side of this label handwritten (H | 737), [Tres Marias Is., | W. Mexico. | Forrer.], [♂], [Sp. figured.], [B.C.A.Lep.Rhop. | Pholisora | clytius, | G.&S.], [ Pholisora | clytius sp.n | Type Figd], [Godman-Salvin | Coll. 1912.—23.], [D10] with genitalia pieces glued to this label, [{QR Code} | BMNH(E) 1669520], [MOLECULAR | 0247274691], (426) as the lectotype of Pholisora clytius Godman & Salvin, 1897 . The lectotype’s right hindwing has a tear at the outer margin near the apex where a tiny wing segment is folded down. Images of this specimen photographed by N.V.G. are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-18082E10, molecular NHMUK_0247274691, GenBank ON480064 View Materials , PV550044, 658 base pairs, is: AACTTTATACTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCACCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTCGATCAAATACCTTTATTCGTATGAGCTGTAGGAATCACAGCTTTACTTTTACTTTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATCTTAATACAT CTTTTTTTGATCCTGCTGGTGGAGGTGATCCTATTTTATATCAACATTTATTT
To stabilize nomenclature and define the name C. semitincta objectively, N.V.G. hereby designates a syntype in the USNM collection, a male that bears the following six rectangular labels (1st and 5th handwritten, others printed with handwritten text shown in italics; 4th red and others white): [Colima | Mex.], [Dec | 1922], [RMuller| Collector], [TypeNo. | | U.S. N.M.] no type number is given on the label, [ Bolla | semitincta | Type Dyar], [GENITALIA NO. | X- 32 14 | J.M.Burns 199 1] as the lectotype of Bolla semitincta Dyar, 1924 . The lectotype is missing the left antenna, has its head turned to the left, and both costal folds are partly opened from the base. Images of this specimen photographed by Bernard Hermier (and N.V.G.) are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15109B06, GenBank PV550045, 658 base pairs, is: AACTTTATACTTTATTTTTGGTATTTGGTCTGGTATAGTAGGAACTTCTTTAAGAATATTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATGCGAATTAATAATTTATCT TTCGATCAAATACCTTTATTTGTATGAGCTGTGGGAATTACAGCTTTACTTTTACTCTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATCTTAACACAT CTTTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.