Zopyrion (Zopyrion) xerxes, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 155-156

Zopyrion (Zopyrion) xerxes Grishin, new species

http://zoobank.org/ 7B0DD951-B5E8-49AD-8A50-B6F772AD4F3E ( Figs. 116 part, 117, 118a–c)

Definition and diagnosis. Genomic analysis reveals that a specimen from Honduras identified as Zopyrion sandace Godman & Salvin, 1896 (type locality in Mexico: Guerrero) is genetically differentiated from it at the species level ( Fig. 116); e.g., their COI barcodes differ by 2.6% (17 bp). Therefore, this specimen represents a new species. This new species is similar to Z. sandace and keys to it (E.58.1) in Evans (1953). The new species differs from its relatives by typically being paler and somewhat warmer colored, with better marked dorsal side of wings, including both a submarginal row of darker spots and postdiscal row of paler spots (with subapical ones); by a smaller harpe, gradually narrowing towards the end ( Fig. 118a, c), not terminally rounded as in Z. sandace ( Fig. 118d, f), and by a less robust, narrower long process of the ampulla with the smaller inner lobe ( Fig. 118b vs. e). Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved

by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1041.25. 4:A39T, aly322.41.23:G57A, aly14.4.12:G108A, aly1259.43.1:A48C, aly216.2.1:A148G, aly2012.17.2: T252T (not C), aly116.38.4:G1132G (not T), aly 1689.9.8:G117G (not A), aly88.7.2:C82C (not A), aly84. 9.4:C198C (not T); and COI barcode: A28A, A184T, C367C, 401T, T514C, A550G.

Barcode sequence of the holotype. Sample NVG-19091F01, GenBank PV550052, 658 base pairs: AACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTCTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCATTAATACTTGGGGCCCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTGCCCCCTTCATTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCAGCTAACATTGC TCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCCGTAGGAATTACAGCTTTACTTTTATTATTATCACTGCCTGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACAT CTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 177 (genitalia Fig. 118a–c), bears the following four rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), three white: [ San Pedro Sula, | Honduras | 4-VII-1981 | Robert O. Lehman], [GENITALIA NO. | X- 43 80 | J.M.Burns 199 8], [DNA sample ID: | NVG-19091F01 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Zopyrion (Zopyrion) | xerxes Grishin].

Type locality. Honduras: San Pedro Sula .

Etymology. Sandace was the sister of Xerxes I, a king of the Achaemenid Empire of Persia who ruled from 486 to 465 BC. It seems fitting to use the name xerxes for this new species whose sister was named sandace . The name is a masculine noun in apposition.

Distribution. Currently known only from the holotype collected in Honduras.