Telegonus bifascia ( Herrich-Schäffer, 1869 )

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 87-88

Lectotype designation for Telegonus bifascia ( Herrich-Schäffer, 1869) confirming it and Telegonus tinda (Evans, 1952) as species distinct from Telegonus latimargo ( Herrich-Schäffer, 1869)

Evans (1952) treated Eudamus bifascia Herrich-Schäffer, 1869 (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing, syntype sequenced as NVG-15031C04) and Astraptes latimargo tinda Evans, 1952 (type locality in Brazil: Pará) as subspecies of Telegonus latimargo ( Herrich-Schäffer, 1869) (type locality in tropical America to USA, lectotype sequenced as NVG-15031C08), but he misidentified both E. bifascia and T. latimargo . According to the genomic analysis ( Fig. 61) and phenotypic inspection of the E. bifascia syntype, it is a species closely related to Telegonus siges Mabille, 1903 (type locality in Brazil, specimens known from South Brazil), with the latter taxon placed as a subspecies of the former in the next section. Specimens that Evans misidentified as “ Astraptes latimargo bifascia ” belong to several undescribed species, some of which are discussed below.

The syntype of E. bifascia we sequenced is labeled as a type specimen of this taxon, is from the Herrich-Schäffer collection according to its labels, and matches the original description, parts of which we assemble from the identification keys and translate as: “Underside with a faintly paler outer-marginal quarter to [outer-marginal] sixth [of the wing’s width]. Fringes brown, underside with two broad darker irregular transverse bands through all wings.” Therefore, we agree that this specimen is a syntype. To stabilize nomenclature and define the name E. bifascia objectively, N.V.G. hereby designates this syntype in the MFNB collection with the following eleven rectangular labels (1 st purple, 9 th yellow, others white): [Origin.], [ Eudamus bifascia HS | N. W. 16 Bras. Pr. 24], [Coll. H.–Sch.], [Teleg. Bifascia | HS.], [Bifascia H-Sch.], [14:23.], [Allyn Museum Photo | No. 830113/7,8, | 9,13,14], [Genit. Prep. | SRS-1077], [Zool. Mus. | Berlin], [{QR Code} http://coll.mfn-berlin.de/u/ | 940b09], and [DNA sample ID: | NVG-15031C04 | c/o Nick V. Grishin ] as the lectotype of Eudamus bifascia Herrich-Schäffer, 1869 . The lectotype has a chipped outer margin of the left forewing at about its middle and a deep tear

America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15031C04, GenBank PV550014, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGATGATCAAATTTACAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Genomic sequencing agrees with the label stating “Bras[il].” and places the lectotype with the specimens from Brazil, which is a likely type locality that we should be able to narrow down further by sequencing additional specimens. The label [14:23.] corresponds to the number for Telegonus cretellus ( Herrich-Schäffer, 1869) (type locality in Jamaica as deduced by genomic sequencing and phenotypic comparison (Zhang et al. 2022b)) in Mabille’s catalog, where the locality for T. cretellus is given as “ Brésil ” ( Mabille 1903). This label was not photographed by Hermier before our analysis, and it was not on the T. cretellus lectotype either at that time. This label might have fallen off another cretellus -like specimen and been placed on the E. bifascia lectotype by mistake.

According to the genomic analysis ( Fig. 61) and phenotypic inspection of the Eudamus latimargo lectotype (see below) and comparing it with the specimens that Evans identified as such, Evans’s “ Astraptes latimargo latimargo ” is not this species but is conspecific with the lectotype of Thymele grullus Mabille, 1888 (type locality in Panama: Chiriquí, sequenced as NVG-15031B12), a species-level taxon and not, as currently considered, a synonym of Telegonus latimargo (see below). Thus, inspecting the genomic trees, we see that Telegonus bifascia ( Herrich-Schäffer, 1869) , stat. conf., Telegonus tinda (Evans, 1952) , stat. conf., and Telegonus latimargo ( Herrich-Schäffer, 1869) belong to three different species groups ( Figs. 61, 89) and are valid species that are strongly different from each other genetically.