Telegonus (Rhabdoides) subfuscus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 93-94

Telegonus (Rhabdoides) subfuscus Grishin, new species

http://zoobank.org/ 11069080-89AE-4111-8603-86E70A3E775B ( Figs. 61 part, 63m –o, 71, 89 part)

Definition and diagnosis. A male from Santa Catarina, Brazil (in MGCL collection) identified as “ T. bifascia ” is not even in the same species group with Telegonus bifascia ( Herrich-Schäffer, 1869) (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing, lectotype sequenced as NVG-15031C04) but instead is closer related to the phenotypically different Telegonus cyprus (Evans, 1952) , stat. nov. (type locality in Bolivia) while being genetically differentiated from it at the species level ( Fig. 61); e.g., their COI barcodes differ by 4.3% (28 bp). Therefore, this misidentified “ T. bifascia ” represents a new species. This new species keys (incompletely) to “ Astraptes creteus siges ” C.14.28(e) in Evans (1952) but differs from it (and the very similar T. bifascia ) by the ventral forewing postdiscal band in males being in the middle between discal and apical bands, aquamarine-colored wing bases and body above (not blue or greenish-yellow), darker forewing apex beneath continuing as an outer-marginal darker band, and narrower ventral hindwing dark bands in males. It differs from its sister species T. cyprus by having a much darker appearance beneath, e.g., a reduced pale area by the forewing tornus and the lack of a pale cross-band; more prominent dark spots nearly connected into bands, and a narrower hindwing. The valva is narrower in the middle as a result of a more concave costa and more constricted valva at its transition to the harpe; the ampulla is smaller, nearly triangular in lateral view, and wider separated from the dorsal process of the harpe (by a U-shaped groove); this process is narrower and longer; the harpe is terminally extended and its dorsoposterior margin is with a broad and shallow hump in the middle ( Fig. 63m, o). Due to the cryptic nature of this species (compared to T. bifascia ), most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly537.19.6:C123T, aly275211.5.10:A624G, aly275211.5.10:G630T, aly 1019.10.2: A1041G, aly235.14.1:G1496A; and COI barcode: A28G, T70C, T187C, T382C, T589C, T652C.

Barcode sequence of the holotype. Sample NVG-22078G12, GenBank PV550017, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGGGCAGGATTAGTTGGAACCTCTTTAAGTTTACTTATTCGAACCGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTCCCCTTAATAATAGGAGCCCCTGATATAGCTTTCCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCATCAAGGAGCATCAGTCGACTTAGCAATTTTTTCTTTACACTTAGCTGGTATTTCTTCCATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGACCGAAACTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity

Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 71 (genitalia Fig. 63m –o), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Brazil, S.Catarina | Joinville 200m. | March 13-14, 1984 | McInnis, Coll.], [Genit. Vial | SRS- 3219], [ Telemachus bifascia | ( Herrich-Schäffer, 1869) | ♂ | Det. S. R. Steinhauser], [ CV Covell colln. | MGCL Acc. | 2006-9], [DNA sample ID: | NVG-22078G12 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | subfuscus Grishin]. Paratype: 1♀ NVG-23063F09 Brazil, Espirito Santo, Santa Teresa , elevation 800 m, 13-15-Feb-1972, C. Callaghan leg., genitalia vial SRS-1801 [ MGCL] .

Type locality. Brazil: Santa Catarina , Joinville, elevation 200 m.

Etymology. The name is given for the ventral side (sub -) being darker (fuscus) than in its relatives. The name is a masculine adjective.

Distribution. South Brazil.

Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus .” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished.