Telegonus (Rhabdoides) amazonicus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 90-93

Telegonus (Rhabdoides) amazonicus Grishin, new species

http://zoobank.org/ 28F5F9C3-EC96-4B44-A158-0C912E4B556A ( Figs. 61 part, 63g –h, 69, 89 part)

Definition and diagnosis. Genomic analysis reveals that many specimens formerly identified as Telegonus hopfferi ( Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG-22068G07) are either Telegonus gilberti (H. Freeman, 1969) (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG-15104B08) or closer related to T. gilberti than to T. hopfferi in the Z chromosome and the mitochondrial genome trees ( Fig. 61b, c). Among them, several specimens from the Amazonian region are not in the same clade as T. gilberti but are sister to the clade consisting of Telegonus bifascia bifascia ( Herrich-Schäffer, 1869) (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing of the lectotype NVG-15031C04) and Telegonus bifascia siges Mabille, 1903 , comb. nov. (type locality in Brazil) in the nuclear genome ( Fig. 61a, b) being genetically differentiated from them at the species level and not monophyletic with them in the mitochondrial genome tree ( Fig. 61c) with a COI barcode difference of 1.1% (7 bp). Therefore, they represent a new species. Curiously, T. bifascia , the closest relative according to the nuclear genome ( Fig. 61a, b), lacks the white area along the costal margin at the base of the ventral hindwing characteristic of the new species. This species keys to “ Astraptes alector hopfferi ” C.14.26(a) in Evans (1952) and while having greener rather than bluer overscaling at the wing bases and body above, is darker beneath with the white overscaling much restricted or absent along the forewing costal margin, the central white band is more like a tornal spot, typically not entering the discal cell in males (one paratype has a small whitish cell spot near its posterior end), the greenish area extends farther distad in the discal cell and along the inner margin than along the costal margin, while bluish extends the longest along the costal margin in T. panavenus sp. n. (see above) and about the same level as in the discal cell in other close relatives; no traces of subapical forewing pale spots beneath (or above), but some males have a diffuse paler spot in the middle of the dorsal forewing; females are with such a spot, which may be paler and larger, trapezoidal in the cell CuA 1 -CuA 2 with traces of paler areas in the discal cell and the cell CuA 2 -1A+2A, and the forewing beneath is with a white spot in the posterior half of the discal cell. The ampulla is narrower and closer associated with the dorsal process of harpe; this process is more robust ( Fig. 63h). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly3319.1.3:C45T, aly3762.23.7:G168A, aly3762. 23.7:T150C, aly15386.1.1:C516A, aly15386.1.1:T531A; and COI barcode: T49A, T145C, C349C, T355T, T361T, T424T.

Barcode sequence of the holotype. Sample NVG-14111C03, GenBank PV550015, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTCTCATCTAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 69 (genitalia Fig. 63g, h), bears the following six rectangular labels (2 nd handwritten and others printed), five white: [ BRASIL: Rondonia | 62km S Ariquemes | Faz.Rancho Grande 165m | 10°53'S, 62°80'W. 19-29. | Sept.1996. B.Harris], [ Astraptes | alector], [DNA sample ID: | NVG-14111C03 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E07 | c/o Nick V. Grishin ], [genitalia: | NVG240817-46 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | amazonicus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 10♂♂ and 5♀♀: Brazil, Rondônia, 62 km S of Ariquemes, linha C-20, Fazenda Rancho Grande, G. T. Austin leg. [ MGCL]: 1♂ NVG-24073H10 linha C-20, 10 km E of B-65, 3 km E of, 18-Nov-1992 and 1♂ NVG-24073H11 7 km E of B-65, 14-Nov-1992; 1♀ NVG-24033H09 Pará, 1896, Donckier leg. [ MFNB]; and Amazonas: 1♂ NVG-24073H09 Maués, Rio Apoquitaua, Feb-1999, M. Simon leg. [ MGCL]; 1♂ NVG-24034B05 Massauari, old, Hahnel leg. [ MFNB]; and 1♂ NVG-24034B03 Tefé, old, Hahnel leg. [ MFNB]; 1♀ NVG-21115D05 Suriname, Berg en Dal, 1873, L. leg. (we were not able to deduce the name behind the abbreviation “L.”) [ MFNB]; 1♀ NVG-14111B11, USNMENT 00275055 Guyana, Eastern Kanuku Mountains, Two Hat Mountain south slope, elevation 850'–1200', GPS 3.1133, −59.0983, 21-28-Sep-2000, S. Fratello et al. leg. [ USNM]; 1♀ NVG-24073G02 Venezuela, Amazonas, Puerto Ayacucho, 29-Aug-1999, M. Simon leg. [ MGCL]; 1♂ NVG-14111B10 Colombia, Caquetá Department, La Montañita, elevation 350 m, 27-Jan-1971, S. S. & S. Nicolay leg. [ USNM]; Ecuador: 1♂ NVG-19071H06, USNMENT 01588529 Napo Province, Misahualli Jungle Lodge, elevation 450 m, GPS −1.0257, −77.6570, 6-8-Jan-2002, J. P. W. Hall & M. A. Solis leg. [ USNM] and 1♀ NVG-24034B06 Pastaza Province, Sarayacu, old [ MFNB]; Peru: 1♂ NVG-19071H07, USNMENT 01588530 Loreto Region, 25 mi E of Iquitos, Amazon River, Explorama Inn, elevation 200 m, 17-21-Sep-1990, Ron Leuschner leg. [ USNM] and 1♂ NVG-24074A02, Huánuco, Tingo María, ca. 2007, E. C. Knudson leg. [ MGCL]; and 1♂ NVG-24034B04 Bolivia, Beni, Puerto San Mateo, 1891, Garlepp leg. [ MFNB].

Type locality. Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande , elevation 165 m, approx. GPS −10.53, −62.80 .

Etymology. The name is derived from the distribution of this species confined to the Amazonian Region. The name is treated as a masculine noun in apposition.

Distribution. The Amazonian Region, broadly in all countries.

http://zoobank.org/ F10DDFE4-038B-40DF-94D0-FE6F2DAE6772 ( Figs. 61 part, 63i–j, 70, 89 part)

Definition and diagnosis. A sequenced specimen from Panama (in USNM collection) that is phenotypically similar to Ecuadorian Telegonus cyprus crilla (Evans, 1952) , comb. nov. due to the presence of a pale spot in the middle of the dorsal forewing is not monophyletic with it in trees constructed from the autosomes in the nuclear genome ( Fig. 61a) and the mitochondrial genome ( Fig. 61c), and instead is closer related to Telegonus crana (Evans, 1952) , stat. nov. (type locality Guatemala: Geronimo), being genetically differentiated from it at the species level ( Fig. 61); e.g., their COI barcode difference is 3.5% (23 bp). Therefore, this Panamanian specimen represents a new species. This new species keys to “ Astraptes creteus crilla ” C.14.28(b) in Evans (1952) due to the presence of a white spot in the middle of the dorsal forewing, but differs from it by this spot being smaller and stronger overscaled with brown around its edges, the pale area in the ventral forewing discal cell being heavier overscaled with brown, especially along the vein, and a more elongated hindwing. The new species differs from T. crana , to which it is closely related, by being paler, as reflected in having a pale spot and a smear around it in the middle of dorsal forewing; a paler costal area from the base to the middle of the ventral forewing (browner in T. crana ), this area is also merged with the central band; and heavier yellowish overscaling on the ventral hindwing. The ampulla is smaller and wider separated from the dorsal process of the harpe ( Fig. 63i). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1651.38.1:T651C, aly1651.38.1:C1146T, aly839.26.4:G214A, aly839.26.4:A224T, aly536.8.1:G510A, aly276890.2.8:A45A (not G), aly276890.2.8:C63C (not T), aly322.44.3:T42T (not C), aly322.44.3:T52T (not G), aly222.2.10: G90G (not T); and COI barcode: A100C, C220T, T292C, T232C, C364C, T400C, C478C.

Barcode sequence of the holotype. Sample NVG-14111D04, GenBank PV550016, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGAGCAGGATTAGTTGGAACCTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGCGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATAATAGGAGCTCCTGATATAGCCTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAACATCAGTTGACTTAGCAATTTTTTCCCTACACTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAACTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGACCCAGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 70 (genitalia Fig. 63i, j), bears the following five printed rectangular labels, four white: [ PANAMA: Darien | Cana 1550m | 5. VI.1983 | Leg. G. B. Small], [DNA sample ID: | NVG-14111D04 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E08 | c/o Nick V. Grishin ], [genitalia: | NVG240817-47 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | pallidus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Panama: Darién Province, Cana , elevation 1550 m .

Etymology. The name is given for the paler aspect of this species compared to its relatives. The name is a masculine adjective.

Distribution. Currently known only from the holotype collected in eastern Panama.