Telegonus (Rhabdoides) sobrasus, Zhang & Cong & Shen & Song & Grishin, 2025
publication ID |
2643-4806 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B12-7267-FE1F-F94FAA3BFDC3 |
treatment provided by |
Felipe |
scientific name |
Telegonus (Rhabdoides) sobrasus |
status |
new species |
Telegonus (Rhabdoides) sobrasus Grishin, new species
http://zoobank.org/ 6783C93A-E535-4D2A-B6E0-EDAFECE13CDE ( Figs. 61 part, 74u–v, 82, 89 part)
Definition and diagnosis. Our analysis (see above) suggests that Evans misidentified Eudamus oenander Hewitson, 1876 (type locality in Brazil: Pará ). Sequencing of several specimens from South Brazil that
are within Evans’s concept of “ oenander ” reveals that they form a clade sister to Telegonus creteus (Cramer, 1780) and are genetically differentiated from it at the species level ( Fig. 61) with Fst / Gmin /COI barcode difference of 0.23/0.025/0.9% (6 bp). This new species keys to “ Astraptes chiriquensis oenander ” C.14.30(d) in Evans (1952) (Evans misidentified Eudamus oenander Hewitson, 1876 ) and falls within Evans’s concept of this species. The new species is most similar to Telegonus creteus (also within Evans’s concept of “ oenander ”) but differs from it by a shorter and more terminally rounded harpe with a more convex ventral margin in lateral view and a more robust dorsal knob-like process ( Fig. 74u), rounder wings in males, more extensive pale overscaling on the ventral forewing and, correspondingly, more contrasting dark bands, which are also more prominent (compared to T. creteus ) on the dorsal side of wings, a pale brown or yellowish (rather than whitish) and very diffuse tornal area on the ventral forewing, the lack of a green streak along the base of the costal margin on the ventral hindwing, and a more restricted greenish area at the base of the dorsal forewing; and differs from other relatives by the hindwing beneath being dark without a paler submarginal area, only a slightly paler tornal area on the ventral forewing without a defined boundary outlining its, and green (not blue) wings bases above. The ampulla is expanded into a ridge basad reaching half of the valva length, this costa appears bisinuate; the ampulla is separated from the rounded knob-shaped dorsal projection of the harpe by a U-shaped gap ( Fig. 74u). Due to the somewhat cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2487.2.4:G138A, aly2487. 2.4:T147C, aly3686.6.3:A183G, aly619.11.3:T21A, aly619.11.3:C40T; and COI barcode: C82C, A244G, T292C, C319C, A562A.
Barcode sequence of the holotype. Sample NVG-19071H11, GenBank PV550027, 658 base pairs: AACTCTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TGAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 82 (genitalia Fig. 74u, v), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ BRAZIL: Sta Catarina | Joinville, 0-200m | 26 O 19'S 48 O 53'W | 27.XI.1988 | leg. H. Miers], [DNA sample ID: | NVG-19071H11 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119F01 | c/o Nick V. Grishin ], [genitalia: | NVG240817-52 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01588534], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | sobrasus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 6♂♂ and 2♀♀ from Brazil: Bahia? (unlabeled specimens, likely historical collection lot no. 4959, two specimens out of three, from either Bahia or Pará), old, Gomez leg. [ MFNB]: 1♂ NVG- Haensch S. [ MFNB]; Espirito Santo, Leopoldina, 1894 Michaelis leg. [ MFNB]: 1♂ NVG-24028C02 and 1♀ NVG-24028E04; 1♂ NVG-24101B03 Paraná, Antonina, Guaricica Ecological Reserve, 15 m, GPS −25.3078, −48.6950, J. A. Shuey & P. Labus leg., genitalia RAA 0761 [ MGCL]; and Santa Catarina (no detailed locality) [ USNM]: 1♂ NVG-14111D 03 Apr-1945, from S. S. Nicolay collection and 1♂ NVG-18027G07, USNMENT 01465201 from B. Neumögen collection, likely around 1900, Genit. Prep. SRS-1049.
Type locality. Brazil: Santa Catarina , Joinville, elevation ca. 50 m, GPS −26.3167, −48.8833 GoogleMaps .
Etymology. The name is derived from the locality in So [uth]+ Bras [il]+ us and is treated as a masculine noun in apposition.
Distribution. Eastern and southern parts of Brazil.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |