Telegonus (Rhabdoides) panavenus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 82-83

Telegonus (Rhabdoides) panavenus Grishin, new species

http://zoobank.org/ FC50BC91-EE2B-40F6-886D-2322607EB90B ( Figs. 61 part, 63c–d, 65, 89 part)

Definition and diagnosis. Genomic analysis reveals that many specimens formerly identified as Telegonus hopfferi ( Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG-22068G07) are either Telegonus gilberti (H. Freeman, 1969) (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG-15104B08) or closer related to T. gilberti than to T. hopfferi in the Z chromosome and the mitochondrial genome trees ( Fig. 61b, c). Among them, three specimens from Panama and Venezuela are in the Z chromosome clade that is sister to T. gilberti ( Fig. 61b) and are genetically differentiated from it at the species level: with Fst / Gmin /COI barcode difference of 0.30/0.009/ 2.4% (16 bp). Therefore, they represent a new species. This species keys (incompletely) to “ Astraptes alector hopfferi ” C.14.26(a) in Evans (1952) but differs from it by having bluish rather than greenish overscaling at the wing bases and body above (similar to T. gilberti ), the forewing beneath lacking traces of apical pale spots, paler overscaling along the costal margin and the discal cell pale spot are absent or vestigial; the blue area along the costal margin of the dorsal forewing extending distad to approximately the same level as in the discal cell, but extending farther along the inner margin, the forewing in males being uniformly brown distad of the blue third, without a paler area in the middle; and the ampulla being wider separated from the dorsal process of the harpe ( Fig. 63d). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly294.2.1:A591T, aly294.2.1:T1056C, aly294.2.1:A1086G, aly527.10. 9:A55G, aly527.10.9:C117T; and COI barcode: T40C, A43T, T124C, A166G, T424T, T571C.

Barcode sequence of the holotype. Sample NVG-14111B08, GenBank PV550012, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGACGATCAAATTTATAATACT ATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATCACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Institution , Washington, DC, USA ( USNM), illustrated in Fig. 65, bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PANAMA: PANAMA | 5 mi N El Llano | 330m 9°17'N 79°00'W | 18.VI.1978 | leg. G.B.Small], [GENITALIA NO. | X-56 22 | J.M.Burns 2003], [DNA sample ID: | NVG-14111B08 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | panavenus Grishin]. Paratypes: 2♂♂ in USNM: 1♂ NVG-14111B09 (leg DNA extraction, sequenced), NVG-23119E05 (abdomen DNA extraction and dissection) Panama, Veraguas Province, Ballena, 1-3-Feb-1979, G. B. Smal leg. , genitalia NVG240817-44 ( Fig. 63c–d) and 1♂ NVG-14111B12 Venezuela, Nueva Esparta, Isla de Margarita, La Sierra , 500 m, GPS 11.0167, −63.8833, 13- 18-Mar-1988, R. K. Robbins leg.

Type locality. Panama: Panamá Province, 5 mi north of El Llano , elevation 330 m, approx. GPS 9.283, −79.000 .

Etymology. The name is formed from the names of the counties with specimen records Pana [ma] + Ven [ezuela]+ us. The name is treated as a masculine noun in apposition.

Distribution. Currently know from central Panama and Isla de Margarita in Venezuela.