Telegonus (Rhabdoides) fulvimargo, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 115-117

Telegonus (Rhabdoides) fulvimargo Grishin, new species

http://zoobank.org/ BA7F1423-91F4-47A9-930F-F756AC10391C ( Figs. 61 part, 85j–n, 87a, 89 part)

Definition and diagnosis. Several males from southern Peru and eastern Bolivia, some identified in the USNM collection as Telegonus meretrix ( Hewitson, 1876) , stat. rest. (type locality in Ecuador), form a distinct clade in the genomic trees together with T. meretrix , not closely associated with any other species ( Fig. 61). These specimens and Ecuadorian T. meretrix are genetically differentiated from each other at the species level in the nuclear genome ( Fig. 61a, b), however, the difference in the mitochondrial genome is smaller, e.g., their COI barcodes differ by only 0.8% (5 bp). Because these specimens from Peru and Bolivia form a nuclear genome clade prominently separated from T. meretrix , they represent a new species. This new species keys (incompletely) to “ Astraptes chiriquensis meretrix ” C.14.30(c) in Evans (1952) and the two species share extensive brilliant-blue to aquamarine wing bases above almost reaching the discal forewing dark band, broad and nearly cross-connected dark bands on the ventral side of wings, which is overscaled with yellow, particularly in the submarginal area distad and adjacent to the outer dark band and the dark base of the costal margin on the forewing beneath ( Fig. 87). However, the new species ( Fig. 87a) differs from T. meretrix ( Fig. 87b) by darker and more restricted yellow areas and overscaling on the ventral side of wings, stronger overscaled with brown and yellower marginal area more prominent than in T. meretrix , which has more brown scales just along the hindwing margin particularly towards the apex but stronger yellow scaling basad towards the outer dark band and more extensive yellow overscaling between the dark bands over the entire wing (i.e., the new species has a more uniformly colored submarginal plus marginal area distad of the outer dark band); a ventral hindwing postdiscal band that is stronger cut into spots by paler veins (more uniform in T. meretrix ); the spot between veins M 1 and

M 3 protruding basad from the band (closer aligned with other spots in T. meretrix ); and typically smaller overall size. The costa of the valva is evenly convex, the ampulla nearly triangular, broader than in relatives at the base, which is slightly expanded anteriad along the costa; the ampulla is separated from the dorsal projection of the harpe by a U-shaped groove; this projection is typical for the genus in shape and size and distally is not separated from the harpe by an indentation but seamlessly curves towards the posterior end of the harpe, which is shorter than in many congeners, terminally pointed but not elongated, its dorsoposterior margin is evenly convex in lateral view without a central hump ( Fig. 85j, l, n). Due to the cryptic nature of this species and poorly known individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly536.214.1:T42C, aly5745.5.8:C105G, aly5745.5.8:C111G, aly2284.23.3:G101C, aly2284.23.3:A138T; and COI barcode: T106C, C220T, A242T, T337C, A628G, T640C.

Barcode sequence of the holotype. Sample NVG-19075A12, GenBank PV550031, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGACCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTT TAAATAATATAAGATTTTGACTTTTACCTCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACAGGATGAACAGTCTATCCCCCTCTTTCATCTAATATCGC CCATCAAGGAACATCAGTTGATCTAGCAATTTTTTCTTTACATCTTGCAGGTATTTCTTCTATTCTTGGAGCCATTAATTTTATTACAACAATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGAGGGGGAGATCCAATCCTATATCAGCATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 87a (genitalia Fig. 85j, k), bears the following six printed (text in italics handwritten) rectangular labels, five white: [ PERU: Cuzco 1194 m | Quebrada Santa Isabel | Cosñipata Valley 5162 | 22-X-2016 Kinyon], [DNA sample ID: | NVG-19075A12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119F04 | c/o Nick V. Grishin ], [genitalia: | NVG240817-55 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01588547], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | fulvimargo Grishin]. The first DNA sample (sequenced)

dissection. Paratypes: 4♂♂ from Peru: Cuzco: 1♂ NVG-14104B02 Cosñipata Road, Quebrada Quitacalzón, elevation 1050 m, 27-Jan-2013, S. Kinyon leg. [ USNM] and 1♂ NVG-24019E10 Marcapata , old, A. Seitz collection [ SMF] and 1♂ NVG-18027G03, USNMENT 01465197 no detailed locality or date, old, donated by B. P. Clark, genitalia vial SRS-1837 [ USNM] and 1♂ NVG-24064B08 Bolivia, La Paz Department , Sud Yungas Province , Rio Selva Resort , 2500’, GPS −16.203944, −67.794139, 8-Mar- 2000, T . Emmel & S. Schlachta leg., an unnumbered vial with genitalia likely dissected by D. L. Lindsley is pinned between the labels ( Fig. 85l–n) [ MGCL] .

Type locality. Peru: Cuzco, Cosñipata Valley, Quebrada Santa Isabel , elevation 1194 m, approx. GPS −13.0333, −71.5167 .

Etymology. The name is given for the fulvous (rather than “flavous”) ventral hindwing marginal area and is treated as a masculine noun in apposition.

Distribution. Currently known only from the eastern slopes of the Andes in southern Peru and eastern Bolivia.