Telegonus (Rhabdoides) flavifimbro Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 11-13

Telegonus (Rhabdoides) flavifimbro Grishin , new species

http://zoobank.org/ 16CBDDCE-329A-402A-9C25-25D6790F53EC ( Figs. 8 part, 9b–c)

Definition and diagnosis. Genomic analysis reveals that two females from Colombia, initially identified as Telegonus (Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí) are genetically differentiated from it at the species level ( Fig. 8); e.g., their COI barcodes differ by 4.1% (27 bp). Instead, these females form a nuclear genome clade sister to Telegonus (Rhabdoides) flavimargo

Grishin, 2025 (type locality in Costa Rica), also differing from it at the species level, e.g., COI barcodes of the holotypes differ by 4.0% (26 bp), and, therefore, they represent a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952), but differs from it and other relatives by the following combination of characters in females: an iridescent area at the base of the dorsal forewing is similar to or more developed than in T. chiriquensis but less extensive and greener than in T. flavimargo ; the tornal area of the ventral forewing is even darker than in T. flavimargo ; a yellow submarginal region on the ventral hindwing is the broadest close to the middle of the wing and narrowing towards the tornus, slightly broader than in T. flavimargo ; a dark postdiscal band on the ventral forewing that is equidistant from the apical and discal bands (not closer to the apical band); more strongly expressed dark bands on the dorsal forewing; and more saturated in color and brighter orange-yellow fringes on the hindwing. Due to its cryptic nature and unexplored individual variation, this species is best

C52T, aly275209.7.3:G198A, aly3614.1.6:C40T, aly393.1.23:C57G. In the COI barcode, this new species may not differ from others due to mitochondrial introgression among its relatives.

Barcode sequence of the holotype. Sample NVG-24028C10, GenBank PV892286, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATAAAAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 9b, bears the following seven rectangular labels (first four handwritten, others printed), six white: [Columbia | 86 Klbr.], [201.], [ T. chiriquensis | ♀ var.], [chiriquensis | var.], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09ec52], [DNA sample ID: | NVG-24028C10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavifimbro Grishin ] . Paratype: 1♀: NVG-24039F01 Colombia, Boyacá, Muzo , Mar-1918, W. Gerstner leg. [ SMNS] ( Fig. 9c) .

Type locality. Colombia, possibly in the eastern Andes .

Etymology. Formed similarly to flavimargo , the name is given for the orange-yellow fringes (fimbia in Latin), particularly noticeable in the holotype of this species. The name is also longer to indicate a more southern distribution of this species and is treated as a noun in apposition.

Distribution. Currently known only from Colombia.