Telegonus (Rhabdoides) chuchuvianus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 111-112

Telegonus (Rhabdoides) chuchuvianus Grishin, new species

http://zoobank.org/ 54170B26-F116-400F-BFED-C8BE8F1D25E1 ( Figs. 61 part, 81e–g, 83, 89 part)

Definition and diagnosis. Inspection of genomic trees reveals that a large female from Chuchuví, Ecuador, is not closely related to any known species of Telegonus (Rhabdoides) Scudder, 1889 (type species Eudamus cellus Boisduval & Le Conte, [1837] ), originating at the base of the parmenides species group ( Fig. 61). Therefore, this female represents a new species. This species is unique in appearance and differs from its relatives by the following combination of characters in females: larger size; blue wing bases and body above; lack of pale spots on the dorsal side of wings; broadly pale-yellowish area on the ventral forewing from CuA 2 to the inner margin (with a brown spot in the middle by the CuA 2 vein and browner area near the outer margin); an unusual pattern on the dark-brown bands on the ventral forewing: the postdiscal band is removed for the subapical band and is vestigial, closer to and fusing with the discal band in the cell CuA 1 -CuA 2 thus forming a large (1/3 of the cell length) dark-brown rectangle; and two darker brown bands are closer to each other on the ventral hindwing than typical for the genus and flanked by paler brown bands partly separated into spots by darker veins. The lamella postvaginalis is shorter than in relatives, and has a rather straight posterior margin with a central U-shaped notch, which is about a third of the lamella length. This species is not cryptic, but because its males remain unknown and individual variation is unexplored, the most reliable identification is through DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1250.7.1:T195C, aly 1250.7.1:T210C, aly276891.1.3:G129A, aly276891.1.3:T595A, aly276891.1.3:G613A, aly 1675.2.10:G87G (not C), aly1675.2.

and COI barcode: T46C, C202T, A298T, A373T, T400A, T508C.

Barcode sequence of the holotype. Sample NVG-24086F12, GenBank PV550028, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACCTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGTGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCACCAAGGTACATCAGTTGACCTAGCAATTTTTTCATTACATCTTGCTGGTATTTCTTCTATTCTTGGAGCCATTAACTTTATTACAACAATTATTAATATACGAATTAATAAATTATCT TTTGATCAAATACCCTTATTTGTCTGAGCTGTAGGAATTACAGCATTATTATTATTGCTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 83 (genitalia Fig. 81e–g), bears the following five rectangular labels (1 st handprinted, others printed), four white: [ ECUADOR - ESM | CHUCHUVI 800 m | VI-2018], [Mark Simon Colln | MGCL Accession | # 2021-10], [DNA sample ID: | NVG-24086F12 | c/o Nick V. Grishin ], [genitalia: | NVG241220-28 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | chuchuvianus Grishin].

Type locality. Ecuador: Esmeraldas, Chuchuví , elevation 800 m.

Etymology. The name is derived from the type locality and is an adjective.

Distribution. Currently known only from the holotype collected in northern Ecuador.