Phareas serenus Plötz, 1883

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 39

Lectotype designation for Phareas serenus Plötz, 1883

Phareas serenus Plötz, 1883 (Weymer in litt.) was described from an unstated number of specimens from unknown localities. The description given as part of the identification key ( Plötz 1883) can be translated from German as “The hindwing is broadened from the anal angle to vein 4, above with an oval oblique white discal spot, beneath broadly black almost along the entire costal margin. The forewing above at the inner margin of the discal cell with a red longitudinal streak extending to the base, and the row of spots in cells 4–9 is interrupted at vein 6, beneath the base is dark gray.” Only females agree with this description. We located and sequenced (NVG-22091A04) a single syntype of P. serenus in the MFNB collection ( Figs. 33d and 51d). The syntype is from the Weymer collection, is labeled as “ … Serenus Wmr i. l” (for “in litteris”), and was seen by Plötz according to its label, thus agreeing with all the details of the original description. This is likely the only specimen on which the description of P. serenus was based. However, avoiding the assumption of the holotype, to define the taxonomic identity of the name P. serenus objectively, N.V.G. hereby designates a syntype in the MFNB collection, a female illustrated in Figs. 33d and 51d (genitalia Fig. 34a–c) and bearing the following eight rectangular white labels (4 th and the last three printed, others handwritten): [341 | Weymer], [Talaus | Cr393c], [Talaus var | Serenus Wmr i. l | 341 best. v. Plötz.], [Coll. Weymer], [60:2.], [DNA sample ID: | NVG-22091A04 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23082A08 | c/o Nick V. Grishin ], [genitalia: | NVG240817-38 | c/o Nick V. Grishin ] as the lectotype of Phareas serenus Plötz, 1883 . According to the 3 rd label, the name for this species proposed by Weymer in correspondence (“i. l”) is serenus , and this specimen was “identified” (probably just inspected in this case) by Plötz (“best[immt]. v[on]. Plötz”). The number 341 is likely an unpublished Weymer’s collection specimen number, or maybe a specimen No. 341 inspected by Plötz in Weymer’s collection. The 5 th label “60:2.” gives the number for Entheus cramerianus Mabille, 1898 (type locality in South America) in Mabille’s catalog (1903), meaning that this specimen was identified as E. cramerianus by a curator of the MFNB collection. The first DNA sample refers to the extraction from a leg and the second is from the abdomen prior to genitalia dissection. The lectotype is missing the left antenna, and every wing but the right hindwing is chipped once at its outer margin. On the basis of genomic comparison, we deduce that the type locality of P. serenus is in the Amazonian region, possibly in Brazil: Pará. The COI barcode sequence of the lectotype, sample NVG-22091A04, GenBank PV549989, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTCTACCCCCCTCTATCTGCCAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGCGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCCGCAGGAGGAGGGGATCCTATTCTTTATCAACACTTATTT