Phanus ecutinus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 33-34

Phanus ecutinus Grishin, new species

http://zoobank.org/ 03E1BABC-DBC8-4A41-8438-2F0AEB2EA823

( Figs. 25 part, 26–27)

Definition and diagnosis. A female from Ecuador identified as Phanus ecitonorum Austin, 1993 (type locality in Brazil: Rondônia) by G. T. Austin after the dissection of genitalia appears as sister in the nuclear genome tree to several closely related species including P. ecitonorum ( Fig. 25a), differing from it by 4.3% (28 bp) in the COI barcode, and, therefore, represents a new species. This species keys to P. ecitonorum in the key for females in Austin (1993) but differs from it by a narrower brown crevice in the hyaline spot in the forewing discal cell; smaller than the third, two subapical spots near the costa; and a larger dark brown ground color area between the forewing discal and postdiscal spots (e.g., the basal edge of the spot in the M 3 -CuA 1 cell is more excavate). Female genitalia are heavily sclerotized, with broader (in ventral view) lamella antevaginalis and papillae anales; a concave near its posterior end ventral margin of the side lobe of lamella antevaginalis; a deeply notched in the middle lamella postvaginalis with arcshaped and more evenly curved posterior margin on both sides of the notch, which is U-shaped, rounded anteriad and wider posteriad; and a wider, longer, and stronger sclerotized antrum (Fig. 27). Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1042.6.1: G360A, aly 1651.12.7:C153A, aly 1651.12.7:A168G, aly725.22.2:T45C, aly725.22.2:T54C, aly366.11.3: C489C (not T), aly366.11.3:A499A (not G), aly6841.72.2:T42T (not C), aly1931.14.4:T48T (not C), aly1139.62.12:T492T (not A); and COI barcode: A31C, C43T, T226C, T394C, T514C, T589C.

Barcode sequence of the holotype. Sample NVG-24074D06, GenBank PV549987, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGTGCCCCAGACATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGACTCCTCCCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCCGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCACCAAGGTTCATCTGTCGATTTAGCAATCTTTTCCTTACACTTAGCTGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGTATTAGAAATTTATCT TTTGATCAAATACCCTTATTCATTTGAGCCGTTGGAATTACTGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTTTAACTGACCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT

Type material. Holotype: ♀ deposited in the

McGuire Center for Lepidoptera and Biodiversity

Collection, Gainesville, FL, USA ( MGCL),

illustrated in Fig. 26 (genitalia Fig. 27), bears the

following seven printed (text in italics handwritten)

rectangular labels, six white: [ ECUADOR |

Pichincha Province | Hotel Tinalandia | 12 km E

Santa | Domingo de los | Colorados | 750–850 m |

13 May 1988 | leg G&A Austin], [ Phanus vitreus |

(Stoll) | det GT Austin 199 1], [Genitalia Vial |

GTA- 2247], [ Phanus ecitonorum | Austin | det.

G. T. Austin | 1992], [G T Austin colln | MGCL

Acc. | 2004-5], [DNA sample ID: | NVG-

24074D06 | c/o Nick V. Grishin ], and one red

[HOLOTYPE ♀ | Phanus ecutinus | Grishin ].

Type locality. Ecuador: Pichincha, Santo Domingo de los Colorados, Tinalandia Lodge.

Etymology. The name is given for the type locality and is a fusion of Ecu [ador] + Tin [alandia] + us. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected west of the Andes in northern Ecuador.