Perus (Perus) perus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 139-142

Perus (Perus) perus Grishin, new species

http://zoobank.org/ 445F016E-851C-4B10-B4EC-2853F968CA89 ( Figs. 101 part, 102, 103a–d)

Definition and diagnosis. Genomic analysis of specimens identified as Perus (Perus) cordillerae (Lindsey, 1925) (type locality Peru: Lima, Matucana, holotype sequenced as NVG-22043E08) reveals that they partition into two clades genetically differentiated at the species level ( Fig. 101); e.g., their Fst / Gmin /COI barcode differences are 0.36/0.01/1.4% (9 bp). One clade ( Fig. 101 blue) contains the holotype of P. cordillerae , along with specimens from Ecuador, and corresponds to this species. The other clade with specimens from Peru represents a new species. This new species keys to “ Staphylus cordillerae ” (E.32.25) in Evans (1953) and was included by him in that taxon, but differs from it by a rounder, and more robust spiculate process (lobe-shaped) arising from the wider folded-over region of the valva near the ampulla ( Fig. 103a, c)—this process is more elliptical in P. cordillerae and the folded-over region is narrower ( Fig. 103e, j, k); a concave junction between the tegumen and the uncus in lateral view ( Fig. 103a, c)—straighter in P. cordillerae ( Fig. 103e, h); the central dark band on the dorsal forewing

that is mostly uniformly colored, without a strongly developed pale bar in the discal cell within the band; more uniform and weaker at margins yellowish overscaling beneath; and a more weakly developed central pale spot on the ventral hindwing. Due to unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.23.3:C198T, aly1468.14.2:A42G, aly276561.5.1:T763A, aly276561.5.1:A1998T, aly6841.32.4: A777G; and COI barcode: A181G, A325T, 400T, T508A, T557C.

Barcode sequence of the holotype. Sample NVG-7826, GenBank PV550046, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACTTCTTTAAGTATACTTATTCGATCTGAATTAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAACTGATTAGTACCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCCCTTACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATCTTCTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGGGCAATTAATTTTATTACTACTATTATTAATATACGAATTAACAATTTATCA TTTGATCAAATATCTTTATTTGTATGAGCAGTAGGAATTACAGCATTACTTTTATTATTATCCTTACCAGTTCTAGCTGGAGCTATTACTATACTTCTTACAGATCGTAATTTAAATACTT CTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 102a (genitalia in Fig. 103a, b), bears the following five printed rectangular labels, four white: [ PERU, AM, 3 km | S Abra Chanchillo | 06° 49'S, 77° 57'W | 19.ix.99, 2150m | Robbins, Lamas, Ahrenholz], [DNA sample ID: | NVG-7826 | c/o Nick V. Grishin ], [genitalia | NVG170206-11 | Nick V. Grishin ], [USNMENT | {QR Code} | 01321666], and one red [HOLOTYPE ♂ | Perus (Perus) | perus Grishin]. Fringes of the holotype are rather evenly damaged, giving it a somewhat unusual appearance. Paratypes: 2♂♂ and 1♀ from Peru, La Libertad Region, Angasmarca, old [ USNM]: 1♂ NVG-18058H06 (leg DNA extraction, sequenced), NVG-23121C11 (abdomen DNA extraction and dissection), USNMENT 01466752, genitalia NVG240817-74 ( Figs. 102b, 103c, d); 1♂ NVG-23121F02; and 1♀ NVG-23121E12.

Etymology. For this new species from Peru, the name is tautonymous with the genus name and is treated as a masculine noun in apposition.

Distribution. Currently known from the Andean region in northern Peru.