Pellicia tyana Plötz, 1882

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 126-129

Lectotype designations for Pellicia tyana Plötz, 1882 , Arteurotia demetrius Plötz, 1882 , Pellicia violacea Mabille, 1891 , and Pellicia vecina Schaus, 1902

Genomic analysis of primary type specimens of Pellicia Herrich-Schäffer, 1870 (type species Pellicia dimidiata Herrich-Schäffer, 1870 ) reveals many inconsistencies with the current classification ( Mielke 2005). Here, we stabilize nomenclature with lectotype designations. We encountered two problems with 1882 (type locality in South America), and the syntype in MFNB (NVG-15032D11, Figs. 90, 91g) is not conspecific with the syntype in ZSMC (NVG-18056G09, Figs. 90, 91e, f). Both syntypes bear identification labels written by Plötz. Additionally, the ZSMC syntype bears a red label with the first line “ Lectotypus ” but the designation remains unpublished. However, the MFNB syntype (sequenced as

NVG-15032D11) agrees better with the original description and Godman’s (1907) copies (in BMNH and USNM) of unpublished Plötz’s drawing t[afel]. 202 of P. tyana ( Fig. 91h): it has more uniform violaceous overscaling towards the tornus of the ventral hindwing (as the drawing and description: “underside … hindwing lilac-gray in the posterior half” ( Plötz 1882b)) vs. violaceous overscaling in the ZSMC syntype having an appearance of two crossbands in the posterior part of the wing (discal and postdiscal) plus violaceous overscaling along the outer margin. Moreover, the MFNB syntype is indeed from South America , as deduced from genomic sequencing, but the ZSMC syntype is likely to be from Panama, although it bears a label “S America ”. A similar locality label is on a ZSMC syntype of Staphylus vincula ( Plötz, 1886) (type locality in Panama), which was also not from South America , based on genomic comparison (Zhang et al. 2022d). Therefore, we conclude that the syntype in MFNB represents Plötz’s concept of P. tyana better than the ZSMC syntype .

To stabilize nomenclature and define the name P. tyana objectively, N.V.G. hereby designates a syntype in the MFNB collection that is shown in Fig. 91g and bears the following ten labels (1st red, others white; 3rd to 8th handwritten, others printed): [typus], [Coll. Weymer], [ Tyana Pltz | taf 202.], [ Pellicia (156c) | Plana Pl.], [H S | 72 | Weymer], [54 | Weymer], [26:15.], [ Tyana Plötz i l. | Plana Plötz il. | (olim) |Amer.mer.], [{QR Code} http://coll.mfn-berlin.de/u/ | 940b8d], [DNA sample ID: | NVG-15032D11 | c/o Nick V. Grishin ] as the lectotype of Pellicia tyana Plötz, 1882 . Handwriting on the 3rd and 8th labels matches that of Weymer, and on the 4th that of Plötz, and taf[el] 202 is the number of the unpublished Plötz’s drawing of P. tyana mentioned in the original description ( Plötz 1882b). Therefore, this specimen might have been the model for the drawing. The label [26:15.] corresponds to the number for P. tyana in Mabille’s catalog, where the locality for this species is given as “Sao-Paulo” [ Brazil] ( Mabille 1903), the same locality is listed on the unpublished Plötz’s drawing, according to Godman (1907). Therefore, we infer that the type locality of P. tyana is in Brazil: São Paulo. The lectotype is missing its abdomen and both antennae. Images of this specimen ( Fig. 91g) photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032D11, GenBank PV550034, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Second , we found only one syntype for each of the remaining three taxa discussed here. For two of them, Godman’s (1907) copies (in BMNH and USNM) of Plötz’s unpublished drawing agree well with the original description and syntype specimens. However , the drawing of Arteurotia demetrius Plötz, 1882 (type locality in Brazil) ( Fig. 91j) does not, and is so unusual that neither Godman (1907) nor Evans (1953) was able to associate a specimen with the drawing. The original description refers to specimens with the number 5912 in Berlin. Only one specimen ( Fig. 91i) was listed for No. 5912 in the catalog of the MFNB historical collections. This specimen agrees with the original description translated here as: “No hyaline spots. Brown, forewing above with 2 darker, slightly curved crossbands, beneath at the costal margin passed the middle with 3 gray spots. Hindwing beneath predominantly gray, the costal margin [area] and 3 fading bands are brown” ( Plötz 1882b). Conversely, the drawing shows 3 gray bands rather than spots (as in the specimen) on the ventral forewing, and brown with grayish cross-rays on the ventral hindwing, quite different from the specimen and the description. Nevertheless, out of syntypes of all these names we were able to find, the drawing of A. demetrius is most similar to the specimen No. 5912, because this specimen has the most extensive violaceous gray overscaling on ventral hindwing ( Fig. 91i). Overall, we have no reason to doubt the status of the specimen No. 5912 as a syntype and hypothesize that Godman’s copy of Plötz’s drawing t[afel]. 205 is inaccurate ( Fig. 91i vs. j). We doubt that the original drawing was any more accurate because the illustration of A. demetrius in Draudt (1921–1924), which is likely to be an independent copy of the original Plötz’s drawing, is more similar to Godman’s copy than to the syntype .

To stabilize nomenclature and define the name A. demetrius objectively, N.V.G. hereby designates

a syntype in the MFNB collection that is shown in Fig. 91i and bears the following eight labels (1st red, 4th green, others white; 3rd, 4th and 5th handwritten, others printed with handwritten text shown in italics): [Type], [5912], [demetrius | Pl. | type], [ Brasil. Bescke], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4712 | Zool.Mus.Berlin], [{QR Code} http://coll.mfn-berlin.de/u/ | 940ba2], [DNA sample ID: | NVG-15032E12 | c/o Nick V. Grishin ] as the lectotype of Arteurotia demetrius Plötz, 1882 . The number 5912 on the 2nd label refers to a specimen lot documented in the catalog of historical collections. Under the entry 5912, the catalog lists a single specimen of an undetermined species collected in Brazil by Bescke. We guess that it was probably collected near Rio de Janeiro, because Bescke collected there. This general locality is also consistent with the results of genomic sequencing, placing the lectotype among specimens from that region. The lectotype has a nick in the middle of the outer margin of the right hindwing and some damage at the outer margin of the left forewing near the tornus. Images of this specimen ( Fig. 91i) photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032E12, GenBank PV550035, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTACTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Next, lectotypes of the remaining two taxa are designated. To stabilize nomenclature and define the name Pellicia violacea Mabille, 1891 (type locality in Brazil) objectively, N.V.G. hereby designates a syntype in the MFNB collection that bears the following ten labels (1st and 3rd shades of purple, others white; 3rd, 4th, 5th, and 7th handwritten, others printed with handwritten text shown in italics): [Origin.], [Coll. H.—Sch | Brasilien], [arteu.violacea | ♂ type Mab.], [ab Meno | Mab.? | (ich habe Origin.) | (Mab.)], [Rubescens | Plötz | violacea | Mab.], [Coll. | Staudinger], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4711 | Zool.Mus.Berlin], [{QR Code} http://coll.mfn-berlin.de/u/ | 44a098], [DNA sample ID: | NVG-15034E05 | c/o Nick V. Grishin ] as the lectotype of Pellicia violacea Mabille, 1891 . The 3rd and the 4th labels are in Mabille’s and Staudinger’s handwriting, respectively. The lectotype is missing its right hindwing, which is placed in a small triangular envelope pinned with the labels. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). Genomic comparison suggests that the type locality of P. violacea is likely in Rio de Janeiro, Brazil. The COI barcode sequence of the lectotype, sample NVG-15034E05, GenBank PV550036, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

To stabilize nomenclature and define the name Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis) objectively, N.V.G. hereby designates a syntype in the USNM collection that bears the following six labels (4th red, others white; 3rd handwritten, others printed with handwritten text shown in italics): [Petropolis, | Brazil.], [Collection | W.Schaus], [ Pellicia | vecina | type Schs], [Type | No. 5977 | U. S. N. M.], [GENITALIA NO. | 1394 | J.M.Burns 1976], [USNMENT | {QR Code} 00913108] as the lectotype of Pellicia vecina Schaus, 1902 . The lectotype is missing a section of the right hindwing at the tornus and a smaller segment on the left hindwing at the outer margin near the tornus. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-18061C10, GenBank PV550037, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTACTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT