Pellicia (Hemipteris) cina, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 131-134

Pellicia (Hemipteris) cina Grishin, new species

http://zoobank.org/ B301C9F0-F5CA-4B5D-9339-6064F08E7E66

( Figs. 90 part, 92–93)

Definition and diagnosis. Genomic analysis reveals that a specimen from Rondônia, Brazil, identified as Pellicia vecina cyanea Biezanko & O. Mielke, 1973 (type locality Brazil: Rio Grande do Sul, Pelotas), currently treated as a junior subjective synonym of Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis, lectotype sequenced as NVG-18061C10), which furthermore (see above) becomes a junior subjective synonym of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in Brazil, likely São Paulo, lectotype sequenced as NVG-15032D11) due to previous misidentification of P. tyana , is genetically differentiated from and not even monophyletic with P. vecina and Pellicia tyana , and is sister to Pellicia (Hemipteris) naja Steinhauser, 1989 , stat. nov. (type locality in Peru: Madre de Dios, holotype sequenced as NVG-15038E08) differing from it at the species level ( Fig. 90), and, therefore, this specimen represents a new species. This new species keys to “ Pellicia vecina najaoides ” (E.21.5.(a)) in Evans (1953), which is misspelled, misidentified, and was redescribed by Steinhauser as P. vecina naja , but differs from its relatives by the following combination of characters: dorsal forewing has violet gloss between brown bands, dorsal hindwing is dark-brown with 2 prominent paler bars in the discal cell and paler costal margin, ventral hindwing is brown with paler apex (but not as pale as in P. naja ) and paler area along the inner margin, ventral hindwing is brown with paler brown posterior half, paler towards tornus, but not whitish, and with broader than in P. naja dark-brown bands and a prominent dark spot at the tornus; left harpe is armed with prominent teeth on the anterior margin and a sharper, longer tooth directed inwards from the ampulla ( Fig. 93). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly527.12.3:C156T, aly420.21.9:C36T, aly204.15.1:T279C, aly 1113.7.3:T54C, aly 1113.7.3: G78T, however, the COI barcode does not distinguish this species from P. naja .

Barcode sequence of the holotype. Sample NVG-23053D08, GenBank PV550039, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTGTCAGCTAATATTGC TCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACACTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACTATTATCAATATACGAGTTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 92 (genitalia Fig. 93), bears the following six printed (text in italics handwritten) rectangular labels (4 th brownish yellow and the last red): [ BRASIL: Rondônia | 62 km S Ariquemes | linea C-20, 7 km E | B-65, Fazenda | Rancho Grande | 14 November 1990 | leg. D&J Lindsley], [Genetalic Vial | GTA- 875], [ Pellicia vecina | cyanea Biezanko & | Mielke | det. GT Austin 199 1], [photographed | G. T. Austin & J. P. Brock | March 1992], [DNA sample ID: | NVG-23053D08 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Pellicia (Hemipteris) | cina leg., genitalia vial GTA-2138.

Type locality. Brazil: Rondônia, 62 km south of Ariquemes, linha C-20, 7 km east of B-65, Fazenda Rancho Grande .

Etymology. The name is formed from the name of a related taxon, vecina , made shorter for its more northern relative. The name is treated as a feminine noun in apposition.

Distribution. Currently known only from Rondônia, Brazil.

Lingering questions about Pellicia Herrich-Schäffer, 1870

Genomic analysis of many primary type specimens in the genus Pellicia Herrich-Schäffer, 1870 (type species Pellicia dimidiata Herrich-Schäffer, 1870 ) reveals their taxonomic identity and previous misidentifications. As a result, we propose many new synonymies and reinstate several species. However, working with a small sample of specimens and not being able to find primary types of some taxa leaves us with several unanswered questions to address.

First, as we hypothesized (Zhang et al. 2023c), North and Central American specimens previously identified as P. dimidiata Herrich-Schäffer, 1870 are distinct from South American specimens at the species level. We attributed the name P. dimidiata to the South American species based on the taxonomic identity of the syntype from Venezuela, but refrained from designating this syntype a lectotype, searching for possible syntypes from “ Mexico ”. We used the name Pellicia bilinea Mabille, 1889 (type locality in Panama: Chiriquí) as valid for the North and Central American species as the oldest name with a strongly supported taxonomic identity based on a syntype of P. bilinea we located. Here, taking the next step to stabilize nomenclature and define this name objectively, N.V.G. hereby designates a syntype in the MFNB collection that bears the following nine labels (1st purple, others white; 3rd to 6th handwritten, others printed with handwritten text shown in italics): [Origin.], [Chiriqui | Ribbe], [ Pellicia | bilinea | Mab.], [ Pellicia | Bilinea | Mab.], [Bilinea | Mab.], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4713 | Zool.Mus.Berlin], [{QR Code} http://coll.mfn-berlin.de/u/ | 940b91], [DNA sample ID: | NVG-15032E01 | c/o Nick V. Grishin ] as the lectotype of Pellicia bilinea Mabille, 1889 . According to its label, the lectotype was collected in Chiriquí, Panama, by Carl Ribbe. The 3rd and the 4th labels are in Mabille’s and Staudinger’s handwriting, respectively. The lectotype has minor damage to its left hindwing fringe in the middle and at the tornus. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032E01, GenBank PV550040, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACATCATTAAGTTTAATTATTCGATCCGAATTAGGTACCCCTAGATCTTTTATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCTATTACTCTATTAATTTCAAGAAGTTTTGTAGAAAATGGTGTTGGTACAGGTTGAACTGTTTATCCTCCTTTATCTGCTAATATTGC TCATCAAGGTTCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATTAATATACGAATTAACAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCTTTACTTTTATTACTATCTCTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAATCTTAATACAT CTTTTTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

However, an older name, Achlyodes nivonicus Plötz, 1884 (type locality in Mexico) might apply to P. bilinea and become valid for this taxon. According to Godman (1907), A. nivonicus “is doubtless the female of” P. dimidiata (the name Godman used for Mexican specimens) and it was “figured from a damaged specimen” by Plötz, meaning that the illustrated syntype was a female from Mexico, appeared damaged, and was similar to P. bilinea . However, we are not positive about Godman’s synonymy. The original description of A. nivonicus might equally well, if not better, apply to a female of Viuria licisca (Plötz, 1882) (type locality in Nicaragua, the name proposed for male specimen(s)), or even to some damaged female of a Mexican Quadrus (Ouleus Lindsey, 1925) resembling its type species Quadrus (Ouleus) fridericus fridericus (Geyer, 1832) (type locality in Suriname).

The description of A. nivonicus is brief and states (assembled from the key and translated): “Forewing without subapical hyaline spots. The outer margin of all wings is smooth and rounded. Hindwing beneath evenly brownish gray [meaning not paler towards tornus] with dark bands. Upperside black-brown, forewing with three even darker bands. The outer band of the forewing is broken up into

data), differing by the last sentence: “The outer band of the forewing is complete, very indistinct.” In MFNB, we located a likely syntype of A. thiena , which is Q. fridericus fridericus , as currently treated, a dark species as described by Plötz, with a weakly defined continuous dark band near the dorsal forewing margin. Therefore, A. nivonicus should have been dark as well, but P. bilinea females typically have paler brown ground color and narrower dark bands, thus not resembling Q. fridericus .

Conversely, V. licisca females, which are patterned similarly to P. bilinea , are darker, with broader dark bands and sometimes with nearly dark-brown hindwings above (no pattern was mentioned by Plötz for the hindwing, and the hindwing of A. thiena syntype is nearly uniformly dark brown). Both P. bilinea and V. licisca may have a dark marginal band broken up into spots. It is also possible that it might have been a species known today as Quadrus (Ouleus) salvina (Evans, 1953) , which is somewhat similar to Q. fridericus , or some mislabeled and damaged female of another species. To solve this problem, we are searching for syntypes of A. nivonicus and specimens from Mexico that agree with all the information about this taxon as candidates for a neotype. Presently, we tentatively place Achlyodes nivonicus Plötz, 1884 as a junior subjective synonym of Viuria licisca (Plötz, 1882) , because the latter species agrees best with the original description of the former.

Second, we sequenced rather few specimens of Pellicia . While our results confidently resolve the taxonomic identity of primary type specimens and are sufficient to support our major conclusion, further studies are expected to clarify species vs. subspecies boundaries in Pellicia . We observe noticeable genitalic differences for taxa that are rather similar genetically. Sequencing a larger series of specimens of each taxon will enable us to study intra- vs. interspecies genetic differentiation and explain the apparent lack of COI barcode differences and relatively small nuclear genome differences between several species distinct in genitalia.

Third, adding not yet sequenced taxa of Pellicia to the analysis will help us find their place in the taxonomic list and may result in further synonymization of names proposed by Evans (1953), who misidentified the majority of Pellicia taxa, or reinstatement of some species currently treated as synonyms.