Oligoria (Oligoria) tinalandia, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 175-177

Oligoria (Oligoria) tinalandia Grishin, new species

http://zoobank.org/ DEA84675-0EF3-454E-A754-C848A69F0F63

( Figs. 141 part, 142)

Definition and diagnosis. A specimen from the western slopes of the Andes in northern Ecuador is sister to Oligoria (Oligoria) rindgei (H. Freeman, 1969) (type locality in Mexico: Oaxaca), but is genetically

therefore, represents a new species. This new species keys to “ Decinea percosius ” (L.11.7) in Evans (1955) and, while being most similar to its sister O. rindgei , differs from it and other relatives by the following combination of characters in females: hyaline spots are larger than in O. rindgei , three forewing subapical spots are increasing in length from the costal margin, more rectangular (less rounded) spots in cells M 3 -CuA 1 and CuA 1 -CuA 2, two pale spots on both sides of the hindwing, the anterior spot is semi-hyaline and larger than the posterior one, a small pale spot at the end of the discal cell on the ventral hindwing, other pale markings are less developed than O. rindgei , tornal cream-colored area on ventral forewing is less developed, more overscaled with brown in the anterior part of the cell CuA 2 -1A+2A, discal cell cream spot on ventral hindwing is less developed, ventral hindwing is with paler submarginal overscaling from the tornus to the CuA 2 vein. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly522.8.3:G69A, aly 1041.8.1:C42A, aly2178.47.6:G90A, aly168.10.2:G207A, aly3936.4.11:C24G, aly1080.19.1:G111G (not A), aly 1468.7.9:T72T (not C), aly525. 127.2:G277G (not A), aly84.86.1:A81A (not T), aly37338.52.1:A45A (not C); and COI barcode: T22C, A100G, T163T (not C), T367C, T403C, T571C.

Barcode sequence of the holotype. Sample NVG-24065F10, GenBank PV550062, 658 base pairs: AACTTTATATTTTATTTTTGGCATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGAACAGAATTAGGTAATCCAGGATCATTAATTGGGAATGACCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCTTTAATTCTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGC CCACCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTCCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATCACTATATTACTTACTGATCGAAATCTTAATACTT CATTTTTTGATCCAGCAGGAGGAGGGGATCCAATTTTATACCAACATTTATTT

Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 142, bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ ECUADOR | Pichincha Province | Hotel Tinalandia | 12 km E Santa | Domingo de los | Colorados | 750–850 m | 11 May 1988 | leg C&A Austin], [Allyn Museum Photo | No. 901017A-17,18], [Genitalia Vial | SRS- 3829], [ Decinea percosius ? | (Godman) ♀ | det. S. R. Steinhauser], [G.T. Austin colln. | MGCL Accession | #2004-5], [DNA sample ID: | NVG-24065F10 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Oligoria (Oligoria) | tinalandia Grishin]. Genitalia vial was not located in the collection, but a vial with genitalia from a different specimen was pinned next to the holotype.

Type locality. Ecuador: Santo Domingo de los Tsáchilas Province, 12 km east of Santo Domingo de los Tsáchilas, Tinalandia Lodge , elevation 750–850 m.

Etymology. The name is given for the type locality and is a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in the western Andes of Northern Ecuador.