Ochlodes (Ochluma) sylvanoides dempwolfi Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 31-32

Ochlodes (Ochluma) sylvanoides dempwolfi Grishin , new subspecies

http://zoobank.org/ F27AE8D7-F5DA-4B7F-B444-A3343470021A (Figs. 19 part, 20 part, 21e–f)

Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co. ), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level ( Fig. 20a violet and magenta). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree ( Fig. 20a) that partitions into two more strongly supported subclades: northeastern ( Fig. 20a violet, 93% bootstrap) and southwestern ( Fig. 20a magenta, 100% bootstrap). The southwestern clade represents a new subspecies described above. Its sister, the northeastern clade, includes specimens from a wider geographical area from southern Alberta and Saskatchewan in Canada, to North Dakota in the U.S. (Fig. 19 violet). These specimens are characterized by phenotypic and genetic differences from other subspecies of O. sylvanoides and, therefore, represent a new subspecies. This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by being intermediate in appearance between the nominate and the new subspecies described above or O. napa : both sides of wings are paler than a typical nominate specimen ( Fig. 21a), but the marginal brown areas above are also rather wide and more prominently scalloped, with sharply defined edges on the forewing and more diffuse on the hindwing; the ventral hindwing with muted reddish-brown ground color, which is less bright than in the nominate subspecies, but darker than in O. sylvanoides paranapa ssp. n. ( Fig. 21b– d) and both darker and redder than in O. napa ( Fig. 21g –j); and the dorsal pattern of orange bands of spots is unique in terms of each spot being slightly yellower in the middle and more orange around, instead of uniformly toned, as in other subspecies. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly848.2.60: G48A, aly25.8.2:C84T, aly25.8.2:C87T, aly935.4.26:G54A, aly935.4.26:C67T; and the COI barcode does not distinguish this subspecies from others.

Barcode sequence of the holotype. Sample NVG-23032D05, GenBank PV892291, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection , Gainesville, FL, USA ( MGCL), illustrated in Fig. 21e, bears the following five printed rectangular labels, four white: [ND: Slope Co. elev 2560' | East River Road, approximately | 1.75 miles from Burning Coal | Vein Campground 46° 35' 51.1" | N, 103° 27' 24.5" W August 23, | 2023 Leg: W. R. Dempwolf], [ Ochlodes sylvanoides | napa | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-23032D05 | c/o Nick V. Grishin], [ WRD 23,554 ], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | dempwolfi Grishin] . Paratypes: 1♂ and 3♀♀: from USA, North Dakota, Slope Co. data as the holotype except as indicated, [ WRD] : 1♂ NVG-23032D06, WRD 23555 22-Aug-2023 , 1♀ NVG-23032D02, WRD 23551 ; 1♀ NVG-23032D03; WRD 23552 ( Fig. 21f); and 1♀ NVG-23032D04, WRD 23553 East River Road, ca. 18 mi south of Medora , 2647’, 46.698 861, −103.487 417, 22-Aug-2023 .

Other specimens: Due to genetic similarity ( Fig. 20), we currently attribute the following three sequenced specimens from Canada in the CNC to this subspecies but exclude them from the type series because they exhibit some differences compared to the population at the type locality: Alberta: 1♂ NVG-24014A07, CNCLEP 00169968 Taber , 49.787 3, −112.149 0, 16-Aug-1996, T. Pike leg. and 1♀ NVG-24014A06, CNCLEP 00169953 Hwy 880 & US border, 49.000 0, −111.266 7, 16-Aug-1998, R. A. Layberry leg. and 1♂ NVG-24014A05, CNCLEP 00169950 Saskatchewan, Val Marie , 49.246 4, −107.728 3, 10-Aug-1983, R. Hooper leg.

Campground, elevation 2560’, GPS 46.597 5, −103.4568.

Etymology. The name, a noun in the genitive case, honors Bill Dempwolf, the collector of the type series and a friend of the author. An exceptional lepidopterist, Bill is recognized for meticulously curating and assembling one of the finest collections. His generosity has been instrumental in our genomic studies, manifested through both dedicated specimen collection for our lab research and open access to his entire collection for leg sampling and sequencing. His profound contributions to our projects are highly significant and greatly appreciated.

Distribution. Northeastern parts of the range, east of the Rockies from Alberta and Saskatchewan in Canada to North Dakota in the U.S.