Hesperia pahaska tehaska, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 161-163

Hesperia pahaska tehaska Grishin, new subspecies

http://zoobank.org/ B60AB082-28E4-4B12-AA0F-FB84DBD5A043 ( Figs. 126 part, 127, 128 part)

Definition and diagnosis. Genomic analysis reveals that southern populations currently identified as Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co.) form a clade that is distinct from it and are genetically differentiated from other populations at the subspecies level ( Fig. 126); e.g., their COI barcodes differ by 0.8% (5 bp) from the genetically closest subspecies H. p. williamsi. Therefore, these populations represent a new subspecies. This new subspecies keys to “ Hesperia columbia pahaska ” (M.10.5.(b)) in Evans (1955) and statistically differs from other subspecies of H. pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) by a combination of the following characters: typically larger size, larger white spots on the ventral side of wings than in H. pahaska williamsi , ventrally darker and greener than H. pahaska pahaska , and typically with longer, better-defined subapical and submarginal spots on the dorsal forewing. Due to extensive individual variation and possibly cryptic nature of this subspecies, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3598.2.1:C783T, aly3598. 2.1:G610A, aly383.17.7:C1131A, aly383.17.7:A1176T, aly479.9.3:G207A; and COI barcode: T19C, A373G, T386C, A562G, T613C.

Barcode sequence of the holotype. Sample NVG-23049B09, GenBank PV550058, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCACGTA TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCTAATATTGC TCACCAAGGGTCTTCTGTTGATCTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTACTTACTGACCGAAATTTAAATACTT CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

the mitochondrial genome. Ultrafast bootstrap ( Minh et al. 2013) values are shown at nodes. Different subspecies are colored differently: H. pahaska hannawackeri (blue), H. pahaska williamsi (olive), H. pahaska martini (cyan), H. pahaska tehaska sp. n. (purple), H. pahaska hidalgo sp. n. (red), H. pahaska bajanorta sp. n. (green), and H. pahaska pahaska (black, only two specimens shown). Holotypes are labeled in magenta. Gaps in branches indicate that a segment of a branch was cut out to reduce its length (to allow an increase in the font size), i.e., a branch with a gap is longer than shown.

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 127, bears the following six printed (text in italics handwritten) rectangular labels, five white: [TEXAS: | JEFF DAVIS COUNTY | Davis Mtns. | Fisher Hill 6141'], [William W. & | Nadine M. McGuire | coll. 28-VIII -7 7], [Collection of | William W. McGuire], [ FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG-23049B09 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Hesperia pahaska | tehaska Grishin ]. Paratypes: 7♂♂ and 5♀♀ in MGCL unless stated otherwise: USA, Texas: 1♂ NVG-23051B03 Culberson Co., 12 mi S and 10 mi E of Van Horn, 11-May-1973, J. Harry leg.; Jeff Davis Co., Davis Mnts.: 1♂ NVG-10967 SH118 S of McDonald Observatory, GPS 30.6597, −104.0232, 9-Apr-2018, N. V. Grishin leg. [ UTSW], 1♀ NVG-23049B10, 29 mi W of Fort Davis, 28-Aug-1977, W. W. & N. M. McGuire leg., and 1♀ NVG-11128 SH118 nr. Caldwell Ranch, GPS 30.736725, −104.139271, 18-May-2018, N. V. Grishin & J. Zhang leg. [ UTSW]; Presidio Co.: 1♂ NVG-23049B04 3 mi N of Shafter, 29-May-1973, W. W. & N. M. McGuire and 1♀ NVG-23049B05 Shafter, 9-Jun-1961, H. A. Freeman leg.; Brewster Co.: 1♂ NVG-23051A01 10 mi N of Persimmon Gap, 26-May-2008, C. Bordelon & E. Knudson leg., 1♂ NVG-23051B01 USH90, ca 35 mi W of Sanderson, 8-Jun-1974, W. W. McGuire leg., and 1♀ NVG-23051B02 USH90, 14 mi E of Marathon, coll. 26-Jul-1977, ex ovum, W. W. & N. M. McGuire leg.; Pecos Co., USH90, 20 mi W of Sanderson, W. W. McGuire leg.: 1♂ NVG-23049B07 20-May-1973 and 1♀ NVG-23049B08 9-Jun-1974; and 1♂ NVG-23051C10 McCulloch Co., Heart of Texas Roadside, 24-Apr-1980, D. Bauer leg.

Type locality. USA: Texas, Jeff Davis Co., Davis Mts., Fisher Hill , elevation 6141’, approx. GPS 30.6972, −104.0967 .

Etymology. The name is formed from the type locality and is treated as a feminine noun in apposition.

Distribution. Central to West Texas ( USA).