Hesperia pahaska bajanorta, Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 165-166

Hesperia pahaska bajanorta Grishin, new subspecies

http://zoobank.org/ 4F174661-E48E-4C06-AB91-B2451395772F

( Figs. 126 part, 128 part, 130)

Definition and diagnosis. Genomic analysis of two specimens of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) from Baja California, Mexico, places them away from other populations in a clade genetically differentiated at least at the subspecies level ( Fig. 126); e.g., their COI barcodes differ from those of their possible sister H. pahaska hidalgo ssp. n. by 1.8% (12 bp), and, therefore, represent a new subspecies. This new subspecies keys to “ Hesperia columbia pahaska ” (M.10.5.(b)) in Evans (1955) and differs from other subspecies of H. pahaska by a combination of the following characters: paler and more uniformly colored, with paler, more diffuse, and in some specimens narrower marginal brown areas on wings above, especially on the hindwing, which is mostly orange; orange-yellow subapical and submarginal spots on the forewing weakly stand out and are smaller; and smaller white spots and yellower (not greener or redder) hue of the ventral side of wings. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly18826.15.6:T99C, aly18826.15.6:T105A, aly18826.15.6:G135A, aly128.1.3:G183A, aly128.1.3:T204C; and COI barcode: C106T, G166A, A242T, T334C, T346C.

Barcode sequence of the holotype. Sample NVG-23049G10, GenBank PV550057, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCACGTT TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACCGTTTATCCTCCCTTATCCTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACTGACCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 130, bears the following six rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), five white: [ MEXICO. | Baja California Norte: | 6 mi. NW Laguna Hanson, | Sierra Juarez , 22 -Jun-1980 | leg WW McGuire], [+], [Collection of | William W. McGuire], [ FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG-23049G10 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Hesperia pahaska | bajanorta Grishin ]. Paratypes: 8♂♂ the same data as the holotype, except as indicated: 7♂♂ NVG-23049G11, NVG-23049H01, and five not sampled for DNA; and 1♂ NVG-23049G12 4 Jun-1980.

Etymology. The name is formed from the name of the Mexican state with the type locality and is treated as a feminine noun in apposition.

Distribution. Mexico: Baja California Norte.

The genus Ochlodes Scudder, 1872 consists of four subgenera

Inspection of the genomic phylogeny of Hesperiina reveals that the genus Ochlodes Scudder, 1872 (type species Hesperia nemorum Boisduval, 1852 , currently regarded as a subspecies of Hesperia agricola Boisduval, 1852 ) experienced deep radiation ( Fig. 131) and consists of four major clades. We define these clades as subgenera, three of which do not have available names and, therefore, are new, described below.