Hesperia angulis Plötz, 1886

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 186-188

Neotype designation for Hesperia angulis Plötz, 1886

Hesperia angulis Plötz, 1886 was described from an unstated number of specimens from Panama collected by Ribbe ( Plötz 1886). Our literal translation of the description from German is: “Forewing with a yellow-dusted long hyaline spot on the hind margin of the discal cell, an angle-shaped spot in cell 2, a square spot slightly towards the margin in cell 3, a dot in cell 6, and in cell 1 a dust spot, which is much more extensive on the underside. Otherwise, everything is blackish-brown. The forewing is towards the apex, and the hindwing towards tornus stretched. The antenna is almost 2/3 as long as the forewing. (Ribbe.) 24 mm. Panama.”

Searching for syntypes, we found a specimen in the ZSMC bearing a label “ Hesperia Angulis Plötz ” in Plötz’s handwriting in addition to the “ Lectotypus ” label. The lectotype designation has not been

America , not Panama) and does not have a label connecting it to Carl Ribbe , who collected the type(s) according to the original description. Moreover, this specimen does not fully agree with the original description of H. angulis : the hyaline spot in the forewing cell 2 (CuA 1 -CuA 2) is crescent-shaped rather than angle-shaped, the latter is characteristic of specimens from Panama, thus supporting the type locality given in the original description. Therefore, we conclude that this specimen is not a syntype , but likely a specimen that was identified by Plötz as H. angulis , possibly after the original description. Genomic sequencing of this specimen (NVG-18056H08) places it among specimens collected north of Panama, mainly in Guatemala and southern Mexico, further supporting the hypothesis that it is not a syntype .

Next, we searched for syntypes of H. angulis in other collections (see Acknowledgments section for their list), most carefully in the MFNB, where many specimens collected by Ribbe are preserved as part of the Staudinger collection, and also in the ZSMC. Despite inspecting every Damas specimen among the entire Hesperiidae holdings, N.V.G. failed to find a specimen from Panama collected by Ribbe and agreeing with the original description of H. angulis . Therefore, we believe that syntypes of this taxon were lost. Not finding syntypes, we proceeded with the neotype designation because there is an exceptional need to clarify the taxonomic identity of H. angulis and define it objectively due to new species present in the complex, multiple synonymic names, likely incorrect type localities for some taxa, and a non-syntypic specimen, possibly from Mexico or Guatemala, identified by Plötz as H. angulis that is not conspecific with specimens collected in Panama. To address all these problems, hereby, N.V.G. designates the specimen in USNM illustrated in Fig. 148b (DNA sample NVG-23122H05) as the neotype of Hesperia angulis Plötz, 1886 .

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Hesperia angulis Plötz, 1886 , which is necessary because additional species are present among its close relatives; 75.3.2. The characters to differentiate this taxon from others were given in the original description ( Plötz 1886) that was translated above. We regard them as follows, adding male genitalic characters: an elongated hyaline spot along the lower side of the discal cell on the forewing, an angle-shaped hyaline spot in the forewing cell CuA 1 -CuA 2, a square hyaline spot near the base of forewing cell M 3 -CuA 1, a dot-shaped hyaline spot in the forewing cell R 5 -M 1, a diffuse spot of pale scales near the middle of the forewing cell CuA 2 -1A+2A near the 1A+2A vein, this spot is much more prominent on the ventral side, otherwise mostly dark brown; the posteriorly directed spike-like process of the tegumen is not reaching the end of the uncus, the harpe is terminally rounded, with a longer dorsoposterior margin that is finely serrated and with a narrower tooth by the ampulla that is directed anterodorsad, uncus arms are slightly divergent, shorter than in the closest relatives; 75.3.3. The neotype specimen is a male bearing two rectangular white labels (1 st handwritten, 2 nd printed): [Bayano | Pma. Panama | 26 05 74 | G B Small], [DNA sample ID: | NVG-23122H05 | c/o Nick V. Grishin ], and illustrated in Fig. 148b; the neotype is a specimen in excellent condition, has its head tilted to the right, proboscis expanded anteriad, and some scales rubbed off at the bases of both forewings and near the right forewing apex above; 75.3.4. As detailed above, we carefully searched for syntypes of H. angulis in the MFNB and other collections. We failed to find the syntypes among Hesperiidae holdings in these collections and, therefore, believe that they were lost; 75.3.5. The neotype closely agrees with the original description of H. angulis in all characters, as evidenced by comparing the neotype illustrated in Fig. 148b with the characters for this taxon given in the original description ( Plötz 1886) and listed above (75.3.2.); 75.3.6. The neotype is from Panama: Panama, and the original type locality was in Panama, which may be narrowed down to central Panama, in contrast to Chiriquí, as usually stated in the labels of specimens collected by Ribbe, who collected the type series; 75.3.7. The neotype is in the National Museum of Natural History, Washington, DC, USA (USNM). The COI barcode sequence of H. angulis neotype, sample NVG-23122H05, GenBank PV550069, 658 base pairs, is: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC CCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAAAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGCGGAGGAGATCCTATTTTATATCAACATTTATTT

Species delimitation and synonymy in the Damas clavus ( Herrich-Schäffer, 1869) complex

Having achieved an objective definition of all names in the Damas clavus ( Herrich-Schäffer, 1869) complex and a better understanding of their type localities, we now proceed with the species delimitation. Genomic analysis of sequenced specimens that included primary types of nearly all available names (except Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia) and Damas woldi Shuey, 2024 (type locality in French Guiana)) reveals that the complex consists of several species ( Fig. 152). Damas clavus ( Herrich-Schäffer, 1869) (type locality in Southeast or South Brazil, lectotype sequenced as NVG-15036D06) is most distantly related to others ( Fig. 152 cyan). Sequenced specimens from Bahia, Brazil, where the lectotype of Hesperia crataea Hewitson, 1876 was collected, are placed within this species. Therefore, we maintain the synonymy of Hesperia crataea Hewitson, 1876 with D. clavus . However, all other taxa currently regarded as synonyms of D. clavus are either distinct species or synonyms of each other. Guided by the name priority, Goniloba corope Herrich-Schäffer, 1869 (type locality in the Amazonian region, lectotype sequenced as NVG-15035A04), Proteides cervus Möschler, 1877 (type locality in Suriname, lectotype sequenced as NVG-15036F09), and Hesperia angulis Plötz, 1886 (type