Gorgopas trochicuz, Zhang & Cong & Shen & Song & Grishin, 2025
publication ID |
2643-4806 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BF9-7280-FE6B-FB18A815FCEC |
treatment provided by |
Felipe |
scientific name |
Gorgopas trochicuz |
status |
new species |
Gorgopas trochicuz Grishin, new species
http://zoobank.org/ DB2C8820-6477-4AF8-B492-4A0E33E7F758 ( Figs. 94 part, 95, 96a–c)
Definition and diagnosis. Genomic analysis reveals that two specimens from Cuzco, Peru, identified as Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG-15032D07) are genetically differentiated from it at the species level in the nuclear genome ( Fig. 94), e.g., an Fst value of 0.3, while not differing significantly in the COI barcode (0.3%, 2 bp only), and, therefore, represent a new species. This new species keys to G. trochilus (E.28.1) in Evans (1953) but differs from it by being darker, with a more diffuse pattern of paler spots on both sides of wings and by narrower valvae with a narrower folded-over region at the costa, smaller and less robust sclerotized inner lobes of harpe, in particular on the right valva ( Fig. 96a–c)—this lobe is larger and more closely connected with the right harpe in G. trochilus ( Fig. 96d–f), which has a broader and rounder right valva, mainly due to a more strongly developed costa with a broader folded-over region. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly383.14.3:G855C, aly383.14.3:G888A, aly1042.34.1:G71A, aly1042.34.1:A167G, aly216.74.1:C48T, and may not confidently differ from G.
specimens: A34A, A70A, T400T, T595T, 616T.
Barcode sequence of the holotype. Sample NVG-7975, GenBank PV550041, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGTACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTAGATTTAACTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCTTTATTTATTTGAGGTGTAGGAATTACTGCATTACTTCTATTATTATCTTTACCAGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATCTTAACACAT CTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 95 (genitalia Fig. 96a–c), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU: Cuzco, 564m. | Pilcopata | Cosnipata Rd 021 | 15-XI-2008 Kinyon], [DNA sample ID: | NVG-7975 | c/o Nick V. Grishin ], [genitalia | NVG170207-60 | Nick V. Grishin ], [USNMENT | {QR Code} | 01321815], and one red [HOLOTYPE ♂ | Gorgopas | trochicuz Grishin] . Paratype: 1♂ NVG-24065B06 Peru, Cuzco, Pilcopata , 600 m, 15-18-Dec-1979, J. B. Heppner leg. [ MGCL] .
Type locality. Peru: Cuzco, Cosñipata Road, Pilcopata , elevation 564 m.
Etymology. The name is a fusion: trochi [lus] + Cuz [co} (for the type locality) and is treated as a noun in apposition.
Distribution. Currently known only from the type locality, which is to the northeast of the Andes in southern Peru.
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.