Gomalia westafra, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 143-147

Gomalia westafra Grishin, new species

http://zoobank.org/ 88CD5D4F-C4D4-4D29-8724-D379F4654CC9 ( Figs. 104 part, 106a–b, 107a)

Definition and diagnosis. Genomic analysis of Gomalia F. Moore, 1879 (type species Gomalia albofasciata F. Moore, 1879 ) reveals that specimens from western Africa form a separate clade in the nuclear genome genetically differentiated from others at the species level ( Fig. 104); e.g., their COI barcodes differ by about 1.8% (12 bp) from Gomalia elma (Trimen, 1862) (type locality in South Africa), by 1.7% (11 bp) from Gomalia litoralis Swinhoe, 1885 stat. rest. (type locality Pakistan: Karachi) and by 6.2% (41 bp) from Gomalia albofasciata Moore, 1879 (type locality in Sri Lanka), and, therefore, represent a new species. In the mitochondrial genome, the new species forms several separate clades, each containing only specimens of this species. This new species keys to “ Gomalia elma ” (III.A.(b 1 )) in (Evans 1937) but differs from it and other relatives by the following combination of characters: tufts of hair-like scales by male genitalia are dark brown; wings are more rounded, darker and less variegated, as especially noticeable on the ventral side; cream hindwing band is narrower and better defined, with darker veins separating it into spots, the spot in the cell CuA 1 -CuA 2 typically overlaps less with the spots between veins M 1 and CuA 1, and stronger sticks out basad from the band; harpe is more robust, with a more convex ventroposterior margin in lateral view; dorsal margin of sacculus is straighter, without a prominent concavity. Due to the partly cryptic nature of this species and poorly explored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.34.6:G33A, aly728.34.6:T69C, aly216.22.9:C33T, aly216.22.9: C69T, aly 2661.9.1:C126T; and COI barcode: A43A, 88T, 424T, C483C, T553C, 646T.

Barcode sequence of the holotype. Sample NVG-24066B03, GenBank PV550047, 658 base pairs: AACATTATATTTTATTTTTGGAATCTGATCAGGAATAGTAGGAACATCTTTAAGATTACTTATTCGATCAGAATTAGGAACACCTGGTTCACTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCTCTTACTCTCTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTCTCAGCTAATATTGC CCACCAAGGATCTTCAGTAGATTTAGCTATCTTTTCCCTTCATTTAGCTGGAATTTCATCTATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAGTTAATAATTTATCT TTTGATCAAATACCTCTTTTTGTTTGAGCTGTTGGAATTACAGCTTTACTTTTATTATTATCTTTACCCGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 106a, bears the following five printed (text in italics handwritten) rectangular labels (3 rd green, 5 th red, others white) [ GHANA | Likpe | 22-xi -196 8 | Fr. Th. Maessen], [A. C. Allyn | Acc. 1969-6], [{QR Code} UF | FLMNH | MGCL 1162140], [DNA sample ID: | NVG-24066B03 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Gomalia westafra | Grishin ]. Paratypes: 4♂♂ and 4♀♀: 1♂ NVG-24066B01, UF FLMNH MGCL 1162125 Côte d'Ivoire, Bouake, 25- Mar-1974, E. Munroe leg. [ MGCL]; Ghana, the same data as the holotype except as specified: 1♂ NVG-24066B02, UF FLMNH MGCL 1162130, 6-Jul-1970, genitalia NVG241111-27 ( Fig. 107a); 1♀ NVG-24066B04, UF FLMNH MGCL 1162146, 7-May-1980; and 1♀ NVG-24066B05, UF FLMNH MGCL 1162148 Hohoe instead of Likpe, 1-Jul-1956; Nigeria: 1♂ NVG-17092B09, USNMENT 00894593 Oyo State, Ibadan, May-Jun-1951, H. J. Sutton leg. [ USNM] and 1♀ NVG-24054B03 Nigeria, Lagos State, Isheri, 5-Oct-1980, H. Kapala leg. [ ZMUC]; and West Africa (no detailed locality, old specimens): 1♂ NVG-19046G11, AMNH _IZC 00346646 [ AMNH] and 1♀ NVG-17069F08, USNMENT 00894397 [ USNM].

Type locality. Ghana: Oti Region , Likpe .

apposition.

Distribution. Western Africa, currently known from Côte d'Ivoire, Ghana, and Nigeria.