Entheus zeus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 34-36

Entheus zeus Grishin, new species

http://zoobank.org/ D6F4DA98-5D23-4697-90C1-DF47DF63DC0A ( Figs. 28 part, 29–30, 50 part, 51a)

Definition and diagnosis. Genomic analysis of Entheus Hübner, [1819] (type species Papilio peleus Linnaeus, 1763 , which is a junior subjective synonym of Papilio priassus Linnaeus, 1758 ) reveals that two males from the Amazonian region in Brazil are close to Entheus gentius (Cramer, 1777) (type locality in Suriname, neotype sequenced as RMNH.INS.907819) but are genetically differentiated from it at the species level ( Fig. 28); e.g., their COI barcodes differ by 1.7% (11 bp). Therefore, these specimens represent a new species. This new species is similar to E. gentius (as defined by its neotype) and keys to it

expanding its width towards the tornus, even broader on the ventral side, orange scales invading the dark border near the dorsal forewing tornus, thus the boundary between orange and dark is not sharply defined, and a tawny turning black towards the end hindtibial tuft; but differs from it by a narrower forewing orange discal band without noticeable hyalinity in the discal cell, even fuzzier boundary between orange and dark brown on the dorsal hindwing, and browner (less black) dark color; the valva is narrower than in E. gentius with a more extended harpe. Due to unexplored individual variation of this species and the lack of known females, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6841.51.2:A1224G, aly6841.51.2: T1386 A, aly6841.51.2: A1416G, aly8478.7.3:G57A, aly8478.7.3:C36G; and COI barcode: T278 T, 376 T, T463 C, A517C, T535 C. Barcode sequence of the holotype. Sample NVG-22017H08, GenBank PV 549988, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGACTATTAATTCGAACTGAATTAGGAACCCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGTTTTTGACTTTTACCCCCATCATTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCACTATCAGCTAATATTGC ACATCAAGGTTCTTCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCA TTTGATCAAATACCACTATTTGTATGAGCAGTCGGTATTACTGCATTACTCTTATTATTATCTTTACCAGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGTGGGGGAGATCCAATTCTTTATCAACATTTATTT

leg., genitalia slide No. 488 ( Fig. 30) [CMNH].

Type locality. Brazil: Amazonas , likely mid-Amazon .

Etymology. We arrived at the name starting from “fuzzy” for the blurred (compared to its relatives) border between dark-brown and orange by the dorsal hindwing tornus of this species: fuzz [y]+[Enth] eus → [fuz] zeus → zeus , and it seems suitable for this bright-orange species fitting to be the king. The name is treated as a masculine noun in apposition.

Distribution. Currently known only from the type locality in the Amazonian region.

Comment. We have not attempted to remount the old genitalia slide No. 488 (currently in the CMNH cabinet with genitalia slides, mostly prepared by R. Williams) and illustrate genitalia here in their original condition, as mounted, without cleaning ( Fig. 30).