Entheus guato, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 55-56

Entheus guato Grishin, new species

http://zoobank.org/ 27E9B5AA-849F-4216-9962-841BA9008949 (Figs. 43d, 44 part, 45, 50 part, 51m)

Definition and diagnosis. Based on an illustration of a spread non-syntypic specimen in Godman and Salvin (1894), Steinhauser (1989) identified specimens from southeastern Chiapas, Mexico (near the border with Guatemala) as Entheus matho Godman & Salvin, 1879 (type locality in Nicaragua: Chontales), as discussed above. According to the taxonomic identity of the E. matho lectotype designated above, these specimens are not conspecific with E. matho and represent a new species. This species is sister to Entheus crux Steinhauser, 1989 (Veracruz, Mexico: Veracruz, Catemaco) and is more genetically distant from E. matho ( Figs. 44, 50), e.g., its COI barcodes differ by 0.9% (6 bp) from E. crux and by 2.9% (19 bp) from E. matho . The description and diagnosis for this new species were given by Steinhauser (1989) for E. matho , because Steinhauser’s E. matho is simply this new species, which he misidentified. In particular, Steinhauser (1989) differentiated it from his newly described E. crux , illustrating male and female genitalia of both species. This new species differs from both E. matho and E. crux by a narrower harpe with a straighter ventral margin (Fig. 43d), but the harpe is much broader with its ventral margin convex in E. matho (Fig. 43a–c). In facies, males of this new species differ from its relatives by more extensive red overscaling above, frequently with a well-developed reddish arc from the base of the forewing discal cell (as in females); and by a straight and broad array of the subapical semi-hyaline amber spots with the two posterior spots not being offset distad along the inner margin of this

reddish overscaling of the dorsal side. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly18826.3.2:A51T, aly18826.3.2:T90C, aly318.26.5:C150T, aly2627.18.2:C81T, aly5294.4.3:T120A; and COI barcode: 49T, T59T, T133C, T499C, A628G.

Barcode sequence of the holotype. Sample NVG-15105A05, GenBank PV549999, 658 base pairs: AACTTTATATTTTATTTTCGGAATCTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGTTTTGGAAATTGACTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTCCCTCGAA TAAATAACATAAGTTTTTGACTTCTACCCCCATCATTAACATTGTTAATTTCTAGAAGAATTGTCGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCAGTAGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCA TTTGATCAAATACCCCTATTTGTTTGAGCAGTAGGTATTACCGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTT

Type material. Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA ( CAS), illustrated in Figs. 45 and 51m, bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEX., Chiapas, | 27 km. S.E. Sta. Rosa | June ’69; P. Hubbell], [Collection of | C. D. MacNeill], [ Entheus matho | matho G.&S. | Det. C.D. MacNeill '87], [] both antennae and a leg are glued to this label, no text, [DNA sample ID: | NVG-15105A05 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Entheus | guato Grishin]. Paratypes: 5♂♂ and 1♀: Mexico, Chiapas: 1♂ NVG-14101C03 no detailed locality, coll. Franck Johnson, genitalia slide G2176 [ AMNH] and Comitán, Santa Rosa, T. Escalante leg. [ MGCL]: 1♂ NVG-23064A12, Specimen no. 29216, Apr-1959, 1♂ NVG-23064A11, Specimen no. 29217, Feb-1960, 1♂ NVG-15026F08, Specimen no. 29215, Apr-1968, and 1♀ NVG-15026F09, Specimen no. 29220, Apr-1968, genitalia SRS-1211; and 1♂ BMNH (E) #1054213 Guatemala, Alta Verapaz Department, Senahú, Champion leg. [ BMNH].

Type locality. Mexico: Chiapas, Comitán, 27 km southeast of Santa Rosa .

Etymology. The name is given for the locality of the specimen misidentified and illustrated by Godman and Salvin (1894) as E. matho . The name is treated as a masculine noun in apposition.

Distribution. Mexico: Chiapas (near the border with Guatemala) and Guatemala.

Comment. The specimen with better DNA preservation was selected as the holotype.