Entheus ecuadius, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 59-60

Entheus ecuadius Grishin, new species

http://zoobank.org/ 297F3822-5303-4CE1-8706-08138124207A ( Figs. 34j–k, 44 part, 48, 50 part, 51q)

Definition and diagnosis. A female from Ecuador is sister to Entheus dius Mabille, 1898 , stat. rest. (type locality in Brazil) and is genetically differentiated from it at the species level ( Figs. 44, 50); e.g., their COI barcodes differ by 2% (13 bp), thus representing a new species. This new species keys to “ Entheus matho dius ” (B.10.5(d)) in Evans (1952) but differs from its relatives by a combination of the following characters: the white area on the hindwing widening towards the inner margin instead of being constricted towards it at vein 1A+2A, smaller white spots on the forewing, and larger separation between the discal cell spot and the spot in cell CuA 1 -CuA 2. Due to the cryptic nature of this species and unexplored

base pairs is diagnostic in the nuclear genome: aly1651.31.1:G24A, aly1651.31.1:A95T, aly2548.15.2: T124C, aly2548.15.2:G168A, aly2548.15.2:C184T, aly1838.35.3:T48T (not C), aly1838.35.3:A66A (not G), aly1838.35.3:T112T (not A), aly6841.32.4:T1008T (not C), aly6841.32.4:T1014T (not A); and COI barcode: T97C, T157T (not C), A316G, T352C, T542T (not C), T595T (not C).

Barcode sequence of the holotype. Sample NVG-14062C11, GenBank PV550002, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACCCCTGGATCATTAATCGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGGGCTGGAACAGGATGAACAGTTTATCCTCCTTTATCCGCTAACATTGC CCATCAAGGATCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATCTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGGGGGGGGGATCCAATTCTTTATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Figs. 48 and 51q (genitalia Fig. 34j–k), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ ECUADOR Napo | Archidona 800m | 10 Nov. '88 | S.S. Nicolay], [DNA sample ID: | NVG-14062C11 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23119E03 | c/o Nick V. Grishin ], [genitalia: | NVG240817-42 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Entheus | ecuadius Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.

Type locality. Ecuador: Napo Province, Archidona , elevation 800 m.

Etymology. The name is formed from the name of its sister species by adding ecua - for the county with the type locality. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in the eastern slopes of the Andes of central Ecuador.