Entheus bogoteus, Zhang & Cong & Shen & Song & Grishin, 2025
publication ID |
2643-4806 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B43-7248-FD99-FC75ADCEFCDE |
treatment provided by |
Felipe |
scientific name |
Entheus bogoteus |
status |
new species |
Entheus bogoteus Grishin, new species
http://zoobank.org/ CA6E6079-3FF2-4347-85D2-AC646FD0EB9F ( Figs. 44 part, 49, 50 part, 51r)
Definition and diagnosis. A male from Bogota, Colombia, identified as Entheus latifascius M. Hering, 1925 , stat. rest. (type locality Colombia, Chocó, Rio Micay) is phylogenetically distant and not monophyletic with it, and instead is sister to Entheus warreni Grishin, 2012 (type locality in Ecuador: Esmeraldas), being genetically differentiated from it at the species level ( Figs. 44, 50); e.g., their COI barcodes differ by 3.0% (20 bp), thus representing a new species. This new species keys to “ Entheus matho latifascius ” (B.10.5(b)) in Evans (1952), males of which he misidentified and incorrectly associated with females, and differs from its relatives by a combination of the following characters: forewing discal band is orange, partly hyaline towards its outer margin, where it is yellower, lacking an
the costa, and the two posterior semi-hyaline spots of the subapical band are strongly (by more than half of their width) offset distad from the rest; the anal fold is creamy-white, slightly yellower towards its sides; the hindtibial tuft is tawny. Due to unexplored individual variation in this species and the lack of known females, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2012.50.2:C133A, aly2012.50.2:C153T, aly5719.4.12:C177G, aly144.43.21:C132A, aly144.43.21:C141G, aly304.5.1:A60A (not G), aly275211.5.10:T849T (not C), aly5294.1.1:T840T (not C), aly923.16.7:C468C (not T); and COI barcode: A61G, A91G, T284C, A312G, T376C, T427T.
Barcode sequence of the holotype. Sample NVG-22042E08, GenBank PV550003, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTGATTCGAACTGAATTAGGAACTCCAGGATCGTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTTCCTCGGA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACACTATTAATTTCTAGAAGAATTGTTGAAAGTGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCTGCTAATATTGC CCATCAAGGATCCTCAGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGTATTTCATCAATCTTAGGGGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCATTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAACTTAAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTCTATCAACATTTATTT
Type material. Holotype: ♂ deposited in the collection of the Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA ( ANSP), illustrated in Figs. 49 and 51r, bears the following four printed (text in italics handwritten) rectangular labels, three white: [BOGOTA | COLOMBIA], [ U. S. N. M. | DIUS MAB. |?], [DNA sample ID: | NVG-22042E08 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Entheus | bogoteus Grishin].
Type locality. Colombia: Bogotá .
Etymology. The name is formed from the type locality and is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected in Bogotá, Colombia.
A preliminary taxonomic list of Entheus Hübner, [1819] species
Here, we integrate our new results into the previous taxonomic arrangement of Entheus Hübner, [1819] (Evans 1952; Steinhauser 1989; Austin 1997; Austin et al. 1997; Mielke 2005; Grishin 2013) to compile a preliminary taxonomic list for the genus and suggest a phylogenetic order of the species. The phylogeny of Entheus ( Fig. 50) generally agrees with phenotypic considerations and division into species groups. The eumelus , gentius , priassus , and matho groups agree with the Evans’s (1952) identification key. However, we find that E. warreni and E. bogoteus sp. n., both of which would be identifiable as members of the matho group by the presence of a separate orange spot between the forewing orange bands in males, are not monophyletic with E. matho and form a clade sister to the priassus group. Therefore, we define a separate species group for them. Furthermore, in agreement with discussions by Austin (1997) and Austin et al. (1997) based on phenotypic differences and similarities, we partition the priassus group into three subgroups, distinguishing the telemus and pralina subgroups, which are closely related to each other and fully separate only in the nuclear genome tree ( Fig. 50a).
We attempt to order species to maximize the phenotypic similarity and geographic proximity of the list neighbors but without disrupting phylogenetic orders given in genomic trees ( Fig. 50): i.e., a strongly supported clade in the trees is a continuous segment in the list. The evolution and diversification of Entheus are riddled with complexities due to the incongruence of the genomic trees ( Fig. 50). Most notably, Entheus latifascius M. Hering, 1925 , stat. rest. (type locality in Colombia: Rio Micay) is confidently placed deep within the matho group in the nuclear genome tree inferred from autosomes ( Fig. 50a), but is sister to the priassus group in both the Z chromosome and the mitochondrial genome trees ( Fig. 50b, c). Until such discrepancies are explained, we side with phenotypic similarity in choosing between the conflicting phylogenetic hypotheses in different phylogenetic trees. Here, we chose to order species groups to maintain the traditional order of Evans (1952), which agrees with phylogenetic trees. Within each group, species are arranged to maximize wing pattern resemblance (within phylogenetic constraints) between neighboring species from different groups, i.e., the brightest member of the priassus group (e.g., E. telemus ) is placed after the gentius group species consisting of brightly colored species, This arrangement results in the placement of E. crux and E. guato sp. n., large species with dark females without a white area on the hindwing, last. Further refinements of the list order are encouraged.
In the resulting arrangement below, we also include two species discovered by Burns and coauthors ( Janzen et al. 2011) but still unnamed, shown in gray font. Based on COI barcode comparison, we hypothesize that the third species, Entheus Burns 03, may be conspecific with E. matho . Type localities (general area only: state, region, department, or county) are in gray font. New taxa described in this study and the category of taxonomic change are in red font. Taxonomic treatment before this work (for valid names) or the category of synonym (for synonyms) and comments (phenotypic characters for species groups and subgroups refer to males) are shown in smaller font following a vertical bar | after the type locality; an equal sign = precedes synonyms given in their original genus combination; and a double dagger ‡ marks permanently invalid synonyms (e.g., objective synonyms) and unavailable names. The list covers 36 valid taxa, all at the species level, with 12 newly proposed here (and 2 yet undescribed) and 6 elevated (from subspecies or synonyms) to the species status: i.e., 16 previously listed as species with 5 additional subspecies and 1 synonym: 22 known and 14 undescribed before this work. Our study follows the trend to reveal approximately as many new Hesperiidae taxa as previously described ones in nearly every genus under revision (Austin and Mielke 1998; Austin and Mielke 2008; Medeiros et al. 2019; Siewert et al. 2020). Because our work on Entheus has not been completed yet, the list below is preliminary, given as a guide to the published knowledge, and with additions to follow.
ANSP |
Academy of Natural Sciences of Philadelphia |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.