Emesis (Mandania) mandarina Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 3-6

Emesis (Mandania) mandarina Grishin , new species

http://zoobank.org/ 98452F55-3EB2-4B5A-84B1-4D1C8FF074BE

( Figs. 2 part, 3)

Definition and diagnosis. Genomic analysis reveals that several specimens from Santa Catarina, Brazil, initially identified as Emesis (Mandania) mandana (Cramer, 1780) (type locality in Suriname) are genetically differentiated from it at the species level ( Fig. 2 ); e.g., their COI barcodes differ by 0.9% (6 bp, barcodes do not differ strongly in this species group ( Zhang et al. 2024, 2025b)), and, therefore, they represent a new species. This new species is similar to its sister E. mandana in having redder colors of the dorsal side in males, but differs from it by a more uniformly colored orange ventral side of the wings without more prominent redder and broader margins and the lack of a defined ventral hindwing spot at the tornus. Males ( Fig. 3a, c ) have smaller and more weakly expressed submarginal dark dots, betterseparated dark markings in the postdiscal row on the ventral side, and typically darker (maroon-toned) background color of the dorsal side. Females ( Fig. 3b ) may have a rounder forewing with a more convex outer margin and a less prominently concave hindwing outer margin at the vein M 2, narrower dashes and crescents in the discal band on the dorsal side with a dash in cell M 2 -M 3 being more strongly offset distad and aligned with the dash in cell M 3 -CuA 1, and paler marginal areas on the ventral side. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: cne4739.1.2:C183T, cne339.14.2:A330T, cne339.14.2:C435T, cne37103.1.5: T462A, cne37103.1.5:T468C; and the COI barcode: T367C, A379C, T578C, T610C.

Barcode sequence of the holotype. Sample NVG-18044E12, GenBank PV892283, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCACGGAGGTTCTTCCGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Washington, DC, USA ( USNM), illustrated in Fig. 3a , bears the following eight rectangular labels (1 st handprinted, others printed with handwritten text shown in italics; 4 th blue, 5 th yellow, the last red, others white): [ Joinville | 18·IX·1982], [StaCatharina | Brazil], [Presented by | Robert E. Aronheim], [ JHALL | -00 05], [ LEGS AWAY | FOR DNA], [DNA sample ID: | NVG-18044E12 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01466379], and [HOLOTYPE ♂ | Emesis ( Mandania) | mandarina Grishin ]. Paratypes: 1♂ and 2♀♀ from Brazil, Santa Catarina (last one likely mislabeled): 1♂ NVG-25013H04 Joinville , 4-Mar-1985, H. Miers leg. [ MGCL] ( Fig. 3c ); 1♀ NVG-24032A05 Blumenau, old, coll. Staudinger [ MFNB] ( Fig. 3b ); and 1♀ NVG-24032A12 “ Colombia | R. Magdalena s”, old , ex coll. H. Stichel, number 3280 [ MFNB] .

Type locality. Brazil: Santa Catarina, Joinville .

Etymology. The name is a fusion given to this relative of mand [ana from Santa Cat] arina, and is treated as a noun in apposition.

Distribution. Currently known only from Santa Catarina in Brazil.

Figures

Fig. 2. Phylogenetic trees of Emesis (Mandania) species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 826,947 positions, and b) the mitochondrial genome. Different species are colored differently: E. mandaca (violet), E. furor A. Butler and H. Druce, 1872 (olive), E. mandora (blue), E. manduza (brown), E. mandana (green), E. mandarina sp. n. (magenta), E. mandela sp. n. (orange), E. mantunga (cyan), and E. russula Stichel, 1910 (black). Labels of specimens from Venezuela are highlighted in yellow in (a).

Fig. 3. Type specimens of Emesis (Mandania) mandarina sp. n. from Brazil: Santa Catarina in dorsal (above or left of the panel letter) and ventral (below or right of the letter) views, data in text: a) holotype ♂ NVG-18044E12; b) paratype ♀ NVG-24032A05; c) paratype ♂ NVG-25013H04.