Emesis (Brimia) boliviana, Grishin, 2024

Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024, Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae), Insecta Mundi 2024 (82), pp. 1-48 : 24-25

Emesis (Brimia) boliviana Grishin, new species

http://zoobank.org/ 9D5266C2-EA39-49B7-9BE2-6652F489A469

( Fig. 4 part, 57–58, 117–118)

Definition and diagnosis. This is a more southern species from the clade sister to Emesis (Brimia) temesa (Hewitson, 1870) (type locality in Ecuador). This new species is phenotypically similar to E. temesa and Emesis (Brimia) apagada , new species (type locality in Peru: Madre de Dios), and differs from them by the hindwing being red beneath up to the postdiscal row of black spots and forewing brown margin being wider than in E. temesa , especially towards the tornus. In male genitalia ( Fig. 117–118 ), the posterior lobe in the middle of vinculum is shorter and more trapezoidal with rounded angles and strongly concave in the middle, uncus is broader and with a smaller central bulge, saccus and the lower valval projection are shorter, the upper valval projection is stronger curved dorsad and very slightly inward. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne10024.5.4:T69A, cne520.3.3:C647T, cne520.3.3:T675C, cne 1657.3.4:A66G, cne15996.2.4:T24C, cne6505.1.20:G347G (not A), cne6505.1.20:T366T (not C), cne3772.15.9:T120T (not C), cne3772.15.9:T133T (not C), cne4809.1.3:T156T (not C), and COI barcode: T88C, T163C, C586C, T595T, T634C.

Barcode sequence of the holotype. Sample NVG-18045D10, GenBank PQ203561, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGTATAGAATTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTCATACCTATT ATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCATCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCACATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCCTTACACTTAGCAGGAATTTCTTCAATT TTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CAGTTGGAATTACTGCTTTATTATTATTATTATCCTTACCAGTATTAGCAGGTGCCATCACTATATTATTAACCGACCGTAATTT AAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 57–58 , bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ BOLIVIA: La Paz Province | San Lorenzo Valley | Rio San Lorenzo 800 m. | 15°48.338’S, 67°29.447’W, 12-19 April 2003 | Brian Harris, coll.], [ Emesis ♂ | temesa | det. Brian Harris 2003], [DNA sample ID: | NVG-18045D10 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114H06 | c/o Nick V. Grishin ], [genitalia | NVG240817-25 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466459], and one red [HOLOTYPE ♂ | Emesis (Brimia) | boliviana Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection.

Type locality. Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, elevation 800 m, GPS −15.8056, −67.4908.

Etymology. The name is formed from the name of the country with the type locality and is a feminine adjective.

Distribution. Currently known only from the holotype collected in western Bolivia.

Emesis (Aphacitis) parvissima Kaye, 1921 is a species distinct from Emesis (Aphacitis) lucinda (Cramer, 1775)

Genomic analysis reveals that Emesis lucinda parvissima Kaye, 1921 (type locality in Trinidad, syntypes sequenced as NVG-21037B02 and NVG-21037B03) currently regarded as a junior subjective synonym of Emesis (Aphacitis) lucinda (Cramer, 1775) (type locality in Suriname) ( Callaghan and Lamas 2004) is genetically differentiated from it at the species level ( Fig. 5 ), e.g., their COI barcodes differ by 6.2% (41 bp), and therefore is not synonymous with it. Moreover, the syntypes of E. lucinda parvissima , together with another specimen from Venezuela (NVG-18044B08) that we identified as this taxon, form a clade sister to Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia) in the nuclear genome trees ( Fig. 5a, b ) and distinct from it at the species level, e.g., their COI barcodes differ by 2.3% (15 bp). In the presence of recognizable phenotypic differences—females of E. lucinda parvissima are darker, with smaller white apical spots on forewing compared to E. aurimna —we propose to treat Emesis (Aphacitis) parvissima Kaye, 1921 , new status, as a species-level taxon.

Figures

Figure 4. Phylogenetic trees of Emesis (Poeasia) and Emesis (Brimia) species (top and bottom clades, respectively) inferred from protein-coding regions in a) the nuclear genome (autosomes), based on 2,139,909 positions, b) the Z chromosome, based on 401,862 positions, and c) the mitochondrial genome: E. (P.) sonorensis sp. n. (green), E. (P.) poeas (purple), E. (B.) temesa (blue, with E. temesa peruviana labeled in cyan), E. (B.) apagada sp. n. (magenta), and E. (B.) boliviana sp. n. (orange). See Fig. 1 caption for other notations.

Figure 5. Phylogenetic trees of Emesis (Aphacitis) species inferred from protein-coding regions ina) the nuclear genome (autosomes), based on 3,692,175 positions, b) the Z chromosome, based on 315,075 positions, andc) the mitochondrial genome: E. aurichica sp. n. (green), E. pruinapicalis sp. n. (red), E. auripana sp. n. (purple), E. aurimna (olive), E. parvissima stat. nov. (blue), E. pallescens sp. n. (magenta), E. furvescens sp. n. (aquamarine), E. glaucescens (gray), E. castigata (pink), E. condigna (brown), E. andigna sp. n. (cyan), E. luxata sp. n. (orange), and E. opaca (lime). See Fig. 1 caption for other notations.

Figures 107–132. Genitalia of holotypes (unless indicated) of Emesis (Tenedia), Emesis (Poeasia), Emesis (Aphacitis) and Emesis (Brimia), data in text. 107–108) E. (T.) alisada sp. n. 109–110) E. (T.) flecta sp. n. 111–112) E. (P.) sonorensis sp. n. 113–114) E. (P.) poeas non-type specimen NVG-23111B11. 115–116) E. (B.) apagada sp. n. 117–118) E. (B.) boliviana sp. n. 119–120) E. (A.) aurichica sp. n. 121–122) E. (A.) auripana sp. n. 123–124) E. (A.) pruinapicalis sp. n. 125–126) E. (A.) furvescens sp. n., aedeagus separated, shown right below the number 125. 127–128) E. (A.) pallescens sp. n. 129–130) E. (A.) andigna sp. n. 131–132) E. (A.) luxata sp. n. paratype NVG-23114H12.

Figures 49–62. Holotypes (unless indicated) of Emesis (Tenedia), Emesis (Poeasia), Emesis (Brimia), and Emesis (Aphacitis), and data in text. 49–52) E. (T.) flecta sp. n.: 51–52) Paratype NVG-18045H01. 53–54) E. (P.) sonorensis sp. n. 55–56) E. (B.) apagada sp. n. 57–58) E. (B.) boliviana sp. n. 59–62) E. (A.) aurichica sp. n.: 61–62) Paratype NVG-18095C02.