Emesis (Aphacitis) bugaba, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 23-24

Emesis (Aphacitis) bugaba Grishin, new species

http://zoobank.org/ 1A2FE025-11D5-4167-A28C-39E8452FE405

( Figs. 19 part, 20)

Definition and diagnosis. Genomic analysis of a pair of specimens from Bugaba, Panama, places them in a nuclear genome clade sister to several species of the subgenus Aphacitis Hübner, [1819] (type species Papilio dyndima Cramer, [1780] , a junior homonym, current name applied to this species is Papilio lucinda Cramer, [1775] ), such as Emesis aurimna (Boisduval, 1870) (type locality in Colombia) and Emesis parvissima Kaye, 1921 (type locality in Trinidad) ( Fig. 19a), and, therefore, this pair represents a new species. In the mitochondrial genome tree, this new species is closest to another Panamanian species, Emesis auripana Grishin, 2024 ( Fig. 19b), likely due to mitochondrial introgression. This new species differs from its relatives by males without a prominent but small pale spot near the forewing apex above (present in E. aurimna ); with a developed apical pale frosting on the dorsal forewing (absent in E. parvissima ), scattered over a wider area and more weakly separated from the rest of the wing by a paler band than in E. auripana and Emesis aurichica Grishin, 2024 (type locality in Mexico: Chiapas), but less distinct than in Emesis pruinapicalis Grishin, 2024 (type locality in Panama: Darien); being redder (rather than yellower) on the ventral side with more diffuse at the margins postdiscal brown bands; and females with a well-developed subapical cream patch and an apical triangle (larger than in E. aurichica ), a paler submarginal smudge in the forewing cell M 2 -M 3, and a stronger developed brown pattern on the beige ventral side. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2443.2.1:A909G, cne 2443.2.1:C912T, cne3195.1.6:A465G, cne243.2.8:A111G, cne5807.10.4:G303A; and COI barcode: A302G, C376T, 508C, T610C, A625A.

Barcode sequence of the holotype. Sample NVG-18053H09, GenBank PV549985, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCGCCATCATTAATTTTATTAATTTCAAGAAGAGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC CCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATGTCA TTTGATCAAATACCATTATTTGTCTGATCTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGTAATTTAAATACAT CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 20a, bears the following five rectangular labels (3 rd handwritten and framed, others

printed; 3 rd green, 5 th red, and others white): [ Panama | Bugaba | e.c.H.Stichel], [3268], [ aurimna Bsd. ], [DNA sample ID: | NVG-18053H09 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Emesis (Aphacitis) | bugaba Grishin]. The 2 nd label gives the specimen number in the Stichel collection. Paratype: 1♀ NVG-24031D06 the same data as the holotype but Stichel collection number 3271 ( Fig. 20b).

Type locality. Panama: Chiriquí Province, Bugaba .

Etymology. The name is given for the type locality and is a noun in apposition.

Distribution. Currently known only from western Panama.