Damas honduras, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 189-190

Damas honduras Grishin, new species

http://zoobank.org/ 3E984A36-0510-48F1-BEE1-4FB2E09D34F4 ( Figs. 148c, 149h–i, 152 part, 153 part)

Definition and diagnosis. Specimens from the northern part of the range of the Damas clavus ( Herrich-Schäffer, 1869) (type locality in Southeast or South Brazil) complex form a clade sister to Damas angulis ( Plötz, 1886) stat. rest. (type locality in Panama: Panama) genetically differentiated from it at the species level ( Fig. 152 green vs. purple); e.g., their COI barcodes differ by 2.0% (13 bp), and, therefore, represent a new species. This new species keys to Damas clavus (K.26) in Evans (1955) and differs from all its

the lower side of the discal cell on the forewing, a crescent-shaped (broader than in a typical D. angulis ) hyaline spot in the forewing cell CuA 1 -CuA 2, a rectangular (longer than a typical square-shaped spot of D. angulis ) hyaline spot near the base of forewing cell M 3 -CuA 1, a dot-shaped hyaline spot in forewing cell R 5 -M 1, a diffuse spot of pale scales near the middle of forewing cell CuA 2 -1A+2A near the 1A+2A vein, this spot is much more prominent on the ventral side, otherwise mostly dark brown; the lower portion of the stigma is nearly square, stronger offset distad from the upper portion, which is elongated rather than triangular; the posteriad-directed process of the tegumen is narrower, the uncus is deeper divided, the harpe is more robust with a broader tooth at the base of its dorsal margin. Due to the cryptic nature of this species and poorly explored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1838.42.1:G96A, aly1838. 42.1:G123A, aly85.33.2:C349T, aly85.33.2:A606G, aly706.2.3:G102A. This species may not differ from D. angulis in the COI barcode, possibly due to introgression (e.g., specimen NVG-23123B02 in Fig. 152b).

Barcode sequence of the holotype. Sample NVG-18093E04, GenBank PV550070, 658 base pairs: AACTTTATATTTTATTTTCGGTGTCTGAGCAGGATTACTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCTTTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTCTACCCCCCCCTTTCATCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAGAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTTTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATACTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Senckenberg Natural History Museum, Frankfurt, Germany ( SMF), illustrated in Fig. 148c, bears the following five printed (text in italics handwritten) rectangular labels (1 st grayish-green, 2 nd and last red, others white): [ Honduras | San Pedro Sula | ex coll. Fruhstorfer], [Para lec- | to typus], [Paralectotypus | Perichares | tripuncta | Draudt, 1923 | O Mielke det 19 79], [DNA sample ID: | NVG-18093E04 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Damas honduras | Grishin ]. The holotype is also a paralectotype of Perichares tripuncta Draudt, 1923 (type locality in Panama: Chiriquí as deduced by the genomic sequencing of the lectotype NVG-18093C07, not S. Brazil). Images of this specimen photographed by E. Brockmann are shown on the Butterflies of America website ( Warren et al. 2024). Paratypes: 9♂♂ and 4♀♀: Mexico, T. Escalante leg. [ MGCL]: 1♂ NVG-24099D02 Chiapas, Santa Rosa Comitán , Sep-1965; 2♂♂ Oaxaca, Chimalapa: NVG-24099D 01 Sep-1963 and NVG-24099C 11 Sep-1965; and 1♂ NVG-24099C12 Veracruz, Catemaco, Sep-1956; Guatemala: Petén, Tikal: 1♂ NVG-22057A08 and 1♀ NVG-22057A05 7-Jan-1990, C. J. Durden leg. [ TMMC] and 1♂ NVG-24099C02, UF FLMNH MGCL 104891 11-Sep-1993, D. L. Lindsley leg. [ MGCL] and Cayuga, old, Schaus & Barns collection [ USNM]: 1♂ NVG-23123A10, genitalia NVG240817-69 ( Fig. 149h, i) and 1♀ NVG-23123A11; 1♀ NVG-24099C01 Belize, Orange Walk District, Gallon Jug, Jan-2006, J. Benner collection [ MGCL]; Honduras San Pedro Sula, old [ MFNB]: 1♂ NVG-24029E03 Coll. Thieme and 1♀ NVG-23075H02; and 1♂ NVG-18056H08 "South America" [likely Guatemala], old [ ZSMC].

Type locality. Honduras: San Pedro Sula .

Etymology. The name rhymes with the genus name and is given for the country with the type locality. The name is treated as a noun in apposition.

Distribution. From southern Mexico to Honduras.

Comment. Note that the genitalia of Damas are sclerotized more weakly than most other Hesperiidae and thus appear paler ( Fig. 149).