Carystus orope Capronnier, 1874

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 184-186

Carystus orope Capronnier, 1874 (Plötz in litt.) is a junior subjective synonym of Tigasis corope ( Herrich-Schäffer, 1869) , not of Damas corope ( Herrich-Schäffer, 1869)

We translate from French the entire original description of Carystus orope Capronnier, 1874 (Plötz in litt.) as: “156. C. Orope , Plötz. Herrich-Schäffer gave to this species the name of Gon. Corope , and to another, the name of Cobalus Corope. Mr. Plötz finds that two similar names in the same family are a cause of confusion, and, to avoid it, he suggests for the species in question the name of Orope. Sept., 18. Botafogo” (Capronnier 1874). The two species mentioned in the description are Goniloba corope Herrich-Schäffer, 1869 (type locality likely in the Amazonian region, lectotype sequenced as NVG-15035A04), currently in the genus Damas Godman, 1901 (type species Goniloba clavus Herrich-Schäffer, 1869 ), and Cobalus corope Herrich-Schäffer, 1869 (type locality likely in Southeast or South Brazil, syntypes sequenced as NVG-15035A02 and NVG-15035A03), currently in the genus Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900 ). We argue that the original description contains a lapsus and Capronnier should have written “Herrich-Schäffer gave to this species the name of Cobalus Corope , and to another, the name of Gon. Corope ,” demonstrating that the two identical species epithets are confusing.

First, the type series of Carystus orope includes not only the specimen(s) collected by van Volxem on September 18, 1872, in Botafogo, Rio de Janeiro, Brazil, and listed explicitly by Capronnier (1874), but also specimens that Plötz considered to be orope , because Plötz is explicitly mentioned in the description, and the name is attributed to him (Capronnier 1874). Second, in the unpublished manuscript by Plötz (in ZSMC) dated 1876 that served as a draft of his publications, he refers to “ Orope m.”, where “m.” is for “mihi” (“of me” in Latin), appended to the species name to indicate authorship of the description, in agreement with Capronnier (1874) who attributed the name orope to Plötz. Both the manuscript and the published version ( Plötz 1882a) list the name “ Corope HS. ” (“HS.” is for Herrich-Schäffer) under Orope, suggesting that Orope and at least part of Herrich-Schäffer’s Corope type series refer to the same taxon and referencing it as “Prodr. 1869. 80. 37.” (in the manuscript) and “Prodr. 1869, p. 80 n. 37. ♀ ” in the publication. The number 37 refers to Cobalus corope (number within Cobalus ), and Goniloba corope is the number 48 (number within Goniloba ) ( Herrich-Schäffer 1869). Page number 80 refers to the page with “37. [ Cobalus ] corope HS ” in “separate reprints” (“Separatabdrücke”) bound as a book ( Herrich-Schäffer 1864 – 1869). Third, Godman’s copy of the original drawing t[afel]. 533 by Plötz showing his “ Hesperia orope ” reproduced here as Fig. 150b agrees with his and Herrich-Schäffer’s descriptions of Cobalus corope and not of Goniloba corope . Fourth, in his Catalogue, Kirby (1877) expressed the same opinion that “ P. Orope , Plötz, ( Carystus O.) Ann. E. Belg. XVII. p. 34. (1874.)” (note the reference to Capronnier (1874)) was “ Cobalus (nec Goniloba ) Corope ”. Fifth, Goniloba corope is an Amazonian species (see the section above) not known from Rio de Janeiro. In contrast, Cobalus corope is distributed in Southeast and South Brazil, where van Volxem collected at least one of the Carystus orope syntypes.

In MFNB, we found and sequenced two syntypes of Cobalus corope , a male (NVG-15035A02) and a female (NVG-15035A03). The female ( Fig. 150a) agrees well with Plötz’s key that specifically mentions a female (possibly meaning that the name orope was proposed for a female of Herrich-Schäffer’s Cobalus corope ) and the drawing ( Fig. 150b) of “ Hesperia orope ” and, therefore, taking into account the discussion above, is a syntype of Carystus orope Capronnier. Moreover , one of the labels of this syntype is “ C. orope Pl. ”, likely written by Mabille. To stabilize nomenclature and define the name C. orope objectively, N.V.G. hereby designates this female syntype in MFNB shown in Fig. 150a that bears

printed with handwritten text shown in italics): [Origin. | corope ], [corope | ♀], [Coll. H.—Sch |], [969.], [ C. orope Pl. ], [51: 10 oder 11], [„ Malaisie “ | (nach Mabille)], [Pa. Orope | Plötz | Corope HS. prop.], [Coll. | Staudinger], [Paralectotypus], [{QR Code} http://coll.mfn-berlin.de/u/ | 3226a2], [DNA sample ID: | NVG-15035A03 | c/o Nick V. Grishin ] as the lectotype of Carystus orope Capronnier, 1874 (Plötz in litt.). The 2nd label might have been written by Herrich-Schäffer, the 7th and 8th labels and the word “corope ” on the 1st label are in Staudinger’s handwriting, and the 5th label is in Mabille’s handwriting. The 6th label “51: 10 oder 11.” gives the numbers for “ P [renes]. orope, Plötz ” (51: 10) and “ P [renes]. corope, Herrich-Schäffer, Prodr. Syst. Lep. p. 76” (51: 11) in Mabille’s catalog (1903), meaning that this specimen was identified as P. orope or (“oder” in German) P. corope by a curator of the MFNB collection. The lectotype of Carystus orope is simultaneously a syntype of Cobalus corope Herrich-Schäffer, 1869 . The lectotype is missing both antennae, and its left wings are separated from each other by a wider gap than the right wings. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). Genomic comparison suggests that the type locality of C. orope (and Tigasis corope ) is in Southeast or South Brazil. The COI barcode sequence of the lectotype, sample NVG-15035A03, GenBank PV550064, 658 base pairs, is: AACTCTATATTTTATTTTTGGAATTTGAGCAGGTATACTAGGAACTTCCTTAAGTTTATTAATTCGTACAGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGAA TAAATAACATAAGTTTTTGAATACTACCCCCCTCTTTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGC TCACCAAGGTTCATCTGTTGATTTAGCTATCTTTTCTCTTCACTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTATGATCAGTAGGAATTACTGCATTATTATTACTTTTATCTTTACCTGTACTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTT CCTTTTTTGACCCCGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Both phenotypic assessment and genomic analysis place Carystus orope Capronnier, 1874 (Plötz in litt.) as a junior subjective synonym of Tigasis corope ( Herrich-Schäffer, 1869) , not of Damas corope ( Herrich-Schäffer, 1869) ( Fig. 151).