Chirgus (Chirgus) teres, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 151-152

Chirgus (Chirgus) teres Grishin, new species

http://zoobank.org/ 9214666A-C343-4E07-ADAE-E5792AA61A1F

( Figs. 109 part, 112–113)

Definition and diagnosis. As demonstrated above, Chirgus (Chirgus) bocchoris cuzcona Draudt, 1923 (type locality in Peru: Cuzco, lectotype sequenced as NVG-18093A12) is genetically and phenotypically similar to Chirgus (Chirgus) bocchoris bocchoris (Hewitson, 1874) (type locality in Bolivia) rather than to specimens that are traditionally identified as C. bocchoris cuzcona in collections. Genomic analysis of such specimens reveals that they are genetically differentiated from C. bocchoris at the species level and form two clades representing two new species ( Fig. 109). The first new species is from the Andes in Central Peru. It differs from C. bocchoris with Fst / Gmin of 0.48/0.016. Evans (1953) misidentified this species as “ Pyrgus bocchoris cuzcona ” (in part), thus it keys to (G.1.4b) in Evans (1953). It differs from its relatives by a more weakly defined and overscaled with brown central spot on the dorsal hindwing, the lack of mottling on the ventral side with smooth and more connected dark bands on the hindwing, and less distinctly checkered fringes. Due to unexplored individual variation, most reliable identification is

aly6286.6.4:T90A, aly164.59.1:A149C, aly164.59.1:A189C, aly331.12.22:A54G, aly331.12.22:A111T. This species does not differ in COI barcodes from C. bocchoris or a new species described next. It differs, however, in the overall mitochondrial DNA ( Fig. 109c).

Barcode sequence of the holotype. Sample NVG-23058C10, GenBank PV550050, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACC ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGACATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTACCCCCCTCTCTCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTACTTCTTTTATTATCACTTCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 112 (genitalia Fig. 113), bears the following six printed rectangular labels, five white: [12km NNE La Oroya | 4100-4150m | JuninPERU | Jack L. Harry | 14Oct2005], [ MGCL Acc. | #2015-47 | J. L. Harry] [DNA sample ID: | NVG-23058C10 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24067E11 | c/o Nick V. Grishin ], [genitalia: | NVG241111- 31 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | teres Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 2♂♂ in Ernst Brockmann collection: NVG-15083E03 from the type locality, 2000 and NVG-15083E02 from Peru, Pasco Region, C. de Pasco, 4000 m, 2001.

Type locality. Peru: Junín Region, 12 km north-northeast of La Oroya, elevation 4100–4150 m .

Etymology. In Latin, teres means smooth or round, highlighting a curved form with a smooth surface. The name reflects the ventral hindwing pattern of smoother and rounder curves and smoother, not variegated, overscaling compared to the closest relatives of this species. The name is an adjective.

Distribution. The Andes of central Peru.