Chirgus (Chirgus) sombrus, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 153-154

Chirgus (Chirgus) sombrus Grishin, new species

http://zoobank.org/ B729E05D-7B8C-4283-9E32-47EF5892A115

( Figs. 109 part, 114–115)

Definition and diagnosis. As demonstrated above, Chirgus (Chirgus) bocchoris cuzcona Draudt, 1923 (type locality in Peru: Cuzco, lectotype sequenced as NVG-18093A12) is genetically and phenotypically similar to Chirgus (Chirgus) bocchoris bocchoris (Hewitson, 1874) (type locality in Bolivia) rather than to specimens that are traditionally identified as C. bocchoris cuzcona in collections. Genomic analysis of such specimens reveals that they are genetically differentiated from C. bocchoris at the species level and form two clades representing two new species ( Fig. 109). The first new species is described above. The second new species is from the Andes in Southern Peru. It differs from the first new species and C. bocchoris with Fst / Gmin of 0.55/0.006 and 0.35/0.035, respectively. Evans (1953) misidentified this species as “ Pyrgus bocchoris cuzcona ” (in part), thus it keys to (G.1.4b) in Evans (1953). It differs from its relatives by a more weakly defined and strongly overscaled with brown central spot on the dorsal hindwing and mottled ventral side, with more angular dark bands on the hindwing mostly separated into spots; fringes are prominently checkered, but mainly in the basal half on the hindwing (the entire hindwing fringe is uniformly checkered in C. bocchoris ). Due to unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly887.8.7:A450G, aly887.8.7:A3153T, aly887.8.7:A3222G, aly2379.20.1:G484T, aly2379.22.10:C147T. This species does not differ in COI barcodes from C. bocchoris or C. teres sp. n. described above. It differs, however, in the overall mitochondrial DNA ( Fig. 109c).

Barcode sequence of the holotype. Sample NVG-23058C12, GenBank PV550051, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACC ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGACATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTACCCCCCTCTCTCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTACTTCTTTTATTATCACTTCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 114, bears the following four printed (text in italics handwritten) rectangular labels, three white: [Ayaviri 4050m | Colquejaua | PunoPERU | Jack L. Harry | 30Oct2005], [ MGCL Acc. | #2015-47 | J. L. Harry], [DNA sample ID: | NVG-23058C12 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | sombrus Grishin]. Paratypes: 3♂♂ and 1♀: 2♂♂ from the type locality: NVG-24068C10 the same data as the holotype [ MGCL] and NVG-17069B06 (leg DNA extraction, sequenced), NVG-23119F10 (abdomen DNA extraction and dissection), USNMENT 01321973, James H. Baker collection, 14-Feb-1970, genitalia vial NVG240817-61 ( Fig. 115) [ USNM]; and from Peru, Cuzco, R. F., B. D. Denno, M. J. Raupp leg. [ MGCL]: 1♂ NVG-15092G03 9 km N of Cuzco, Ruinas Tambomachay, 3500 m, 10-Feb-1980 and 1♀ NVG-15092G04 (leg DNA extraction), NVG-24067E10 (abdomen DNA extraction and dissection), 6 km N of Cuzco, Ruinas Qenqo, 3-Mar-1980, genitalia vial NVG241111-30.

Type locality. Peru: Puno Region, Melgar Province, Ayaviri , elevation 4050 m .

Etymology. In Spanish, sombra means shadow, given for the darker dorsal hindwing with a “shaded” central white patch that identifies this species. The name is treated as a masculine noun in apposition.

Distribution. The Andes of southern Peru.

Comment. This species was previously referred to by the name Pyrgus bocchoris cuzcona (Draudt, 1923) (or Chirgus bocchoris cuzcona ), a misidentification.