Chirgus (Chirgus) argentinus, Zhang & Cong & Shen & Song & Grishin, 2025
publication ID |
2643-4806 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BEA-729F-FE3D-FA6CA8FDFF39 |
treatment provided by |
Felipe |
scientific name |
Chirgus (Chirgus) argentinus |
status |
new species |
Chirgus (Chirgus) argentinus Grishin, new species
http://zoobank.org/ 6D8855C3-80A6-4F0F-8461-517F01A8427A
( Figs. 109 part, 110–111)
Definition and diagnosis. A specimen from Argentina initially identified as Chirgus limbata (Erschoff, 1876) (type locality in Peru) ( Fig. 109 orange) is genetically differentiated from it at the species level in the nuclear genome ( Fig. 109a, b), e.g., the Fst for their comparison is 0.24, and is not monophyletic with it in the mitochondrial genome tree ( Fig. 109c), which is riddled with introgression. Therefore, this specimen represents a new species. This new species keys to “ Pyrgus limbata limbata ” (G.1.2.(a)) in Evans (1953) but differs from its relatives by a combination of the following characters: the pale spot in the middle of the dorsal hindwing discal cell is either absent or vestigial and the discal band (sometimes reduced to a central spot) is separated from the paler costal area, which may be vestigial; the ventral hindwing is paler and with a more contrasting dark pattern on it consisting of two bands (sometimes
only slightly darker than the area between the two bands, without paler dots inside (usually darker in C. limbata , and may be with paler dots between veins); fringes are typically stronger checkered than in C. limbata . Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly525.91.4:A76T, aly525.91. 4:A78T, aly 1196.3.1:C306T, aly 1196.3.1:T327C, aly587.15.1:C265T, aly619.10.5:G90G (not A), aly102.6.2: G543G (not A), aly102.6.2:C549C (not T), aly208.16.7:A24A (not T), aly208.16.7:G48G (not A). In the COI barcode, this species may not differ from some specimens of its relatives due to introgression.
Barcode sequence of the holotype. Sample NVG-15092G11, GenBank PV550049, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGGAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACATTACTTATTTCAAGTAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCCTTACTTCTTTTATTATCATTGCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 110 (genitalia Fig. 111), bears the following seven rectangular labels (2 handwritten, others printed), six white: [ ARGENTINA Jujuy | (Tumbaya) | Purmamarca to Rt. | 40, Rt 52 km 38, | 4170 m 21-i-88 Leg | R Eisele 88J5], [♂], [ MGCL Accession | #2011-4 | Robert Eisele], [DNA sample ID: | NVG-15092G11 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-24068C09 | c/o Nick V. Grishin ], [genitalia: | NVG241111-32 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | argentinus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1♀ NVG-24068C08 Argentina, Jujuy, Tilcara Department, Cerro Sisilera, 15 km SE of Huacalera, 4550 m, 20-Dec-1990, David Greenman leg. [ MGCL].
Type locality. Argentina: Jujuy Province, Tumbaya Department, Purmamarca to Rt. 40, km 38 of Rt. 52, elevation 4170 m .
Distribution. Argentina.
Comment. Published records of Chirgus limbata from Argentina ( Gomariz 2020; Núñez-Bustos 2023) likely refer to this species.
R |
Departamento de Geologia, Universidad de Chile |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.