Cecropterus (Thorybes) coxeyi (Williams, 1931)
publication ID |
2643-4806 |
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B3D-724B-FEBA-FEB9ABF2FDBD |
treatment provided by |
Felipe |
scientific name |
Cecropterus (Thorybes) coxeyi (Williams, 1931) |
status |
|
Cecropterus (Thorybes) coxeyi (Williams, 1931) is a species distinct from Cecropterus (Thorybes) egregius (Butler, 1870)
Genomic analysis of Eudamus coxeyi Williams, 1931 (type locality Ecuador: Huigra, holotype sequenced as NVG-15096B02), currently treated as a subspecies of Cecropterus (Thorybes) egregius Butler, 1870 (type locality not specified), reveals that the two taxa are genetically differentiated at the species level ( Fig. 53); e.g., their Fst/Gmin/COI barcode difference are 0.37/0.014/1.2% (8 bp). The former taxon differs from the latter by being paler: e.g., forewing semi-hyaline spots are larger, the ventral hindwing ground color is pale brown, and hindwing fringes are white (Evans 1952). Therefore, we propose that Cecropterus (Thorybes) coxeyi (Williams, 1931) , stat. rest. is a species distinct from Cecropterus (Thorybes) egregius (Butler, 1870) . As a result, C. egregius becomes monotypic. The COI barcode sequence of the holotype of C. coxeyi , sample NVG-15096B02, GenBank PV550004, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGTACTGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATCACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTCTACTTTTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTT
from Cecropterus (Thorybes) virescens (Mabille, 1877)
Genomic analysis of Eudamus chlorothrix Röber, 1925 (type locality Peru: Pasco, Huancabamba, holotype sequenced as NVG-18094D06), currently treated as a junior subjective synonym of Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “Cayenne” [ French Guiana?], syntype sequenced as NVG-15029F10), reveals that the two taxa are genetically differentiated at the species level ( Fig. 53); e.g., their Fst/Gmin/COI barcode difference are 0.18/0.012/2.3% (15 bp). Therefore, we propose that Cecropterus (Thorybes) chlorothrix (Röber, 1925) , stat. rest. is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877) . The COI barcode sequence of the holotype of C. chlorothrix , sample NVG-18094D06, GenBank PV550005, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCGGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGGGCCATTACTATACTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.