Carterocephalus biseriatus Weymer, 1890

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 147-149

Lectotype designation for Carterocephalus biseriatus Weymer, 1890

Carterocephalus biseriatus Weymer, 1890 was described from two specimens from the high plateau in Bolivia and illustrated in the original description as reproduced here in Fig. 108a (Weymer and Maassen 1890). Evans (1953) synonymized this name with Hesperia ( Syrichthus [sic]) limbata Erschoff, 1876 , the type of and currently a valid species in the genus Chirgus Grishin, 2019. We located and sequenced a syntype (labeled as “ Lectotypus ”, although this designation was not published) ( Fig. 108b) and a specimen identified as C. biseriatus placed next to the syntype in the drawer ( Fig. 108c). Phylogenetic trees constructed from protein-coding genes in the nuclear genomes revealed that the two specimens were not conspecific ( Fig. 109). The syntype was grouped with the specimens of Chirgus barrosi (Ureta, 1956) (type locality in Chile), and the other specimen was placed among Chirgus nigella (Weeks, 1902) (type locality in Bolivia). Phenotypic inspection agreed with this conclusion, and differing ventral wing patterns of the specimens were consistent with such placement ( Fig. 108b, d vs. c). Evans’s (1953) decision to synonymize Carterocephalus biseriatus with C. limbata instead of C. nigella was probably due to the original description and illustration (Evans did not have a chance to inspect the syntype) indicating a single pale spot on the brown ground color of the dorsal hindwing (more consistent with C. limbata ) ( Fig. 108a), while both the syntype and the other specimen exhibit more extensive pale patterns (more characteristic of C. nigella ) ( Fig. 108b, c).

The other specimen, although being from the Maassen collection and identified as C. biseriatus , is not likely to be a syntype because it has antennae intact, but the original description states that both syntypes lacked the antennae (Weymer and Maassen 1890). Moreover, judging from the handwriting, the identification label placed on this specimen was written by a different person, possibly by Mabille (after publication of the name), while the identification label on the syntype may have been written by Weymer, based on the handwriting on these labels. Conversely, the syntype we found agrees well with the original description and illustration of C. biseriatus . It is even possible that the ventral side illustration shows the right wings of this syntype: the hindwing has two rows of spots (3 and 5 spots), uniformly ochre-yellow otherwise, and the forewing is paler in the discal area than typical for this species. The artist might have mistaken the scale damage on this forewing for the pattern and illustrated a broader pale band instead of a narrow band of smaller pale spots. The dorsal side illustration is not particularly similar to this syntype: it is darker with much smaller pale spots and only one central spot on the hindwing. It might have depicted the second syntype (possibly not even conspecific with the first one), which we could not locate.

a syntype we found in the MFNB collection (shown in Fig. 108b) with the following eight rectangular labels (1st red, others white): [Lectotypus], [3083], [Coll. | Stübel], [Tacora], [ Bolivien | Hochplateau | 3600-4600 m.], [ Carterocephalus biseriatus Weym ], [{QR Code} http://coll.mfn-berlin.de/u/ | 80a6f2], and [DNA sample ID: | NVG-15033H08 | c/o Nick V. Grishin ] as the lectotype of Carterocephalus biseriatus Weymer, 1890 . The lectotype has scales rubbed off on both sides in the discal area of the right forewing, a feature even depicted in the original illustration of the ventral side (Weymer & Maassen, 1890: pl. 4, fig. 7). Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15033H08, GenBank PV550048, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGAAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACATTACTTATTTCAAGTAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCCTTACTTCTTTTATTATCATTGCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT