Burnsius communis altus Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 24

Burnsius communis altus Grishin , new subspecies

http://zoobank.org/ 5DF6A207-4270-414E-91DB-8104C19B2452 ( Figs. 14 part, 15g –k, 16c–d)

Definition and diagnosis. Genomic analysis reveals that populations from the central Sierra Nevada, California, currently assigned to Burnsius communis communis (Grote, 1872) (type locality in USA: central Alabama), belong to a distinct and strongly supported (99%-100% ultra-fast bootstrap values) clade in the nuclear genome trees (together with the northwestern subspecies described above) genetically differentiated from others at the subspecies level ( Fig. 14 magenta vs. green) and phenotypically different from them. Therefore, they represent a new subspecies that keys to “ Pyrgus communis communis ” (G.1.10(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a costal fold in males; the harpe dorsally with two prongs ( Fig. 16c) and the valva usually broader than in the northwestern new subspecies described above, with a pronounced costal hump typical of specimens from most of the range—see Burns (2000) for illustrations; the wings usually darker above with smaller white spots and areas ( Fig. 15g –k), but paler than in the northwestern new subspecies ( Fig. 15a–d), and with better-defined dark framing of ventral spots, bands, and veins; and a less olive, duller tone of the ventral bands. Due to significant and poorly characterized individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly451.12.5:T86G, aly276378. 20.2:A24G, aly276378.20.2:C57T, aly276378.20.2:T60C, aly 1656.6.2:C1106G; but no barcode differences.

Barcode sequence of the holotype. Sample NVG-23057F09, GenBank PV892289, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 15g, (genitalia Fig. 16c, d), bears the following six printed rectangular labels, five white: [ CALIF.: Tuolumne Co. | 4 mi. S of Mill Creek | at CA Hwy. 108 , 6500 | ft.; 30.vi.1987 | L.D. & J.Y. Miller | sta. no. 4], [Allyn Museum | Acc. 1987–8], [DNA sample ID: | NVG-23057F09 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24067E03 | c/o Nick V. Grishin], [genitalia: | NVG241111-29 | c/o Nick V. Grishin] and one red [HOLOTYPE ♂ | Burnsius communis | altus Grishin]. The first DNA sample refers to the extraction from a leg (sequenced) and the second is from the abdomen (stored) prior to genitalia dissection . Paratypes: 3♂♂ and 3♀♀: USA, California: Placer Co., B. O’Hara leg. [ MGCL] : 1♂ NVG-23058D09 Soda Springs Rd. 2.9- 4.1 mi S. of Donner Pass Rd., 27-Jul-1992 and 1♂ NVG-23058D08 Squaw Valley Ski Area , 8200-8500’, 6-Jun-1994; El Dorado Co. [ CNC] : 1♂ NVG-24012E04, CNCLEP_00163011 Fallen Leaf , 13-Jul-1961, J. G. Chillcott leg. ( Fig. 15j) and 1♀ NVG-24012E05, CNCLEP_00163017 Echo Lake, 13-Jul-1961, B. H. Poole leg ( Fig. 15k); and Tuolumne Co., Stanislaus National Forest , 21-Jul-2022, W. R. Dempwolf leg. [ WRD] : 1♀ NVG-23032C11, WRD 22431 near Niagara Campground , 6870’, 38.320 6, −119.911 4 ( Fig. 15i) and 1♀ NVG-23032C12, WRD 22432 near Mill Creek Campground, 6525’, 38.312 6, −119.939 8 ( Fig. 15h) .

Type locality. USA: California, Tuolumne Co., 4 mi south of Mill Creek at SR 108, elevation 6500 ft.

Etymology. In Latin, altus means high, deep, or tall, and is given for the typical habitat of this subspecies at higher elevations. The name is an adjective.

Distribution. Currently known from the central Sierra Nevada in California, USA (Placer, El Dorado, and Tuolumne Counties), where it comes close to and may overlap at times with the nominate subspecies, especially at lower elevations.