Anisochoria bacchoides, Zhang & Cong & Shen & Song & Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 156-158

Anisochoria bacchoides Grishin, new species

http://zoobank.org/ C3887697-B08C-4BD4-9A8B-B2E76F59D016

( Figs. 119 part, 120–121)

Definition and diagnosis. Genomic sequencing of several specimens from El Salvador and Chiapas, Mexico, reveals that they are genetically differentiated from Anisochoria bacchus Evans, 1953 (type locality Mexico: Veracruz, Atoyac) at the species level ( Fig. 119); e.g., their COI barcodes differ from A. bacchus by 2.9% (19 bp). Therefore, these specimens represent a new species. This new species keys to “ Anisochoria pedaliodina bacchus ” (E.59.1.(a)) in Evans (1953) and was included within this taxon.

subapical forewing spots are in a straighter line nearly at a right angle with the costa, the line drawn through them from the costal spot is directed towards the tornus rather than towards the spot in cell M 3 - CuA 1; spots in cell M 3 -CuA 1 and the lower spot in the discal cell are farther apart from each other than in A. bacchus ; spots in the discal cell are usually smaller in size; and the process of the ampulla is longer compared to the harpe. Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly85.36.7: A81G, aly528.11.7:C43T, aly3512.6.1:T144C, aly3512.6.1:A165T, aly3512.6.1:G214A; and COI barcode: T50C, T112C, A160G, 274C, T463C, T539C.

Barcode sequence of the holotype. Sample NVG-23054D06, GenBank PV550053, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCACTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATGTTAGGGGCACCCGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAACATTATTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATCGC TCATCAAGGATCTTCTGTAGATTTAGCTATTTTCTCCCTTCACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTCATTACTACAATTATTAACATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTCTGAGCTGTAGGAATTACTGCTATTCTTTTACTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACAT CTTTTTTTGACCCTGCTGGAGGTGGGGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 120, bears the following five printed (text in italics handwritten) rectangular labels, four white: [La Libertad, El Sal. | 10m. | 15-XII-72 | No. H-6039 | Leg S.&L.Steinhauser], [ ANISOCHORIA PEDALIODINA | BACCHUS Ev. ♂ | Det: S. R.Steinhauser], [A. C. Allyn | Acc. 1973-23], [DNA sample ID: | NVG-23054D06 | c/o Nick V. Grishin ], and one red

[ HOLOTYPE ♂ | Anisochoria | bacchoides Grishin]. Paratypes: 2♂♂ and 3♀♀: 1♂ NVG-20062H03 (leg DNA extraction, sequenced), NVG-24015E07 (abdomen DNA extraction and dissection) Mexico, Chiapas, Tuzantán, Rio Huixtla 7 mi N of Huixtla, 7-Aug-1988, J. Kemner leg., genitalia vial NVG241114-13 ( Fig. 121) [ TMMC]; Guatemala, Santa Rosa , Guazacapán, ex coll. E. Le Moult [ MGCL]: 1♂ NVG-23054D04 5-Apr-1922 and 1♀ NVG-23054D05 1-Mar-1923; and El Salvador: 1♀ NVG-19091G08 Santa Tecla, 19-Dec-1953, Mauricio Salazar leg. [ USNM] and 1♀ NVG-23054D07 Rio El Molino , nr. Ahuachapán, S. and L. Steinhauser leg. [ MGCL] .

Type locality. El Salvador: La Libertad, elevation 10 m.

Etymology. The name is formed from the name of its sister species, A. bacchus , made longer for this more southern relative. The name is treated as a feminine noun in apposition.

Distribution. Currently known from southern Chiapas ( Mexico), Guatemala, and El Salvador.