Mariapanteles dapkeyae Fernandez-Triana
|
publication ID |
https://dx.doi.org/10.3897/zookeys.208.3326 |
|
persistent identifier |
https://treatment.plazi.org/id/ED957277-6705-0E85-81C8-15EE1E5E0A8F |
|
treatment provided by |
|
|
scientific name |
Mariapanteles dapkeyae Fernandez-Triana |
| status |
sp. n. |
Mariapanteles dapkeyae Fernandez-Triana ZBK sp. n. Figs 7-12
Holotype.
Female (CNC).BRAZIL: Mato Grosso, Sinop; x-xi.1975, Malaise Trap; M. Alvarenga col.
Paratype.
5 Females and 4 Males (CNC, with 1 female each deposited in INHS and BMNH). Same data as for holotype, except for collecting date (x.1974 for all specimens but two males with collecting date: x.1975). Two males deposited in the CNC have DNA Voucher codes: CNCHYM 03387 and CNCHYM 07145. 1 Female (CNC). BRAZIL: Goiás, Jatai; xi.1972; F. M. Oliveira col.
Description.
Female. Antenna about the same length as body; body length 2.4 mm; forewing 2.6 mm. Head. Face with shallow and sparse punctures and sparse, uniformly distributed setae. Face width at antennal base/face width at clypeus edge: 1.1 ×; intertentorial pit distance/face width at clypeus edge: 0.4 ×; compound eye height/head height: 0.8 ×; head height/width: 0.8 ×; face width at antennal base/head maximum width: 0.5 ×; malar space/basal width of mandible 1.4 ×; clypeus width/height: 3.5 ×. Length/width of flagellomeres: 2nd (2.4 ×), 8th (2.5 ×), 14th (1.3 ×). Length of flagellomere 2nd/length of flagellomere 14th: 2.2 ×. Ocello-ocular distance/posterior ocelli diameter: 2.2 ×; distance between posterior ocelli/ocelli diameter: 1.3 ×.
Mesosoma. Pronotum with two lateral grooves present, the lower one excavated. Mesoscutum more or less uniformly sculptured by shallowly impressed punctures (distance between punctures about the same as their diameter). Mesoscutum 1.3 × wider than long. Mesoscutum and scutellum uniformly covered by dense, pale yellow pilosity. Scutellum mostly smooth, with very shallow and sparse punctures. Scutellum length/width at base 1.1 ×. Scutellar suture broad, with 4-6 costulae. Posterior band of scutellum polished. Scutellar lateral face with polished area less than 20% the face height and less than half the face width. Mesopleuron mostly smooth and glabrous, except for punctures on the anterior margin and setae on all margins; separated from metapleuron by crenulate sulcus. Metapleuron mostly smooth, with some punctures and setae in the apical half; metapleuron with a crenulated, longitudinal sulcus running from lower margin near metacoxa through spiracle. Metapleural carina raised with a short lamella. Propodeum mostly smooth; with a median carina well defined and raised its entire length; and with a clearly complete transverse carina that reaches the spiracles and forks around them (there are also additional, shorter transverse carinae). Transverse carina on propodeum delimiting two areas, the anterior, basal one that is more or less horizontal, and the posterior, apical one is declivous.
Metasoma. Mediotergite 1 mostly smooth and with a deep medial groove over its basal half; slightly widening for the first quarter of its length, then narrowing t owards apex; basal width/apical width 1.5 ×; length/apical width 3.3 ×. Mediotergite 2 mostly smooth, transverse, subtriangular to trapezoidal in shape; basal width/apical width 0.3 ×; length/apical width 0.4 ×. Mediotergite 3 1.5 × the length of mediotergite 2. Mediotergite 3 and following unsculptured, polished and with sparse setae. Hypopygium mostly inflexible but with a median, translucid fold ventrally where 1-2 weak pleats are sometimes distinguishable. Ovipositor sheaths fully setose, 0.7 × as long as metatibia length.
Legs. Metacoxa long, surpassing the length of the third metasomal tergum. Metatibial inner spur 1.4 × the length of outer spur, and 0.5X the length of metatarsomere 1. Metafemur 3.2 × as long as wide.
Wings. Vein R1a 1.3 × as long as stigma length. Stigma 3.3 × as long as wide. Length of R1a about 14 × as long as the distance between its end and the end of 3RSb. Vein r and 2RS evenly curved to very slightly arched, with no clear limits between the two veins. Vein 2M about the same length of vein (RS+M)b. Edge of vannal lobe of hind wing medially straight to slightly concave and with uniformly distribute setae which are shorter than those at base and apex of the lobe.
Colour: Mostly yellow, with antennal flagellomere, forewing stigma and most of the wing veins, light brown.
Male. Mostly like females, but some specimens with darker interocellar area and mediotergites 3+. We associate these males with these females because of their morphological similarity.
Distribution.
The specimens were collected with Malaise traps in two Brazilian localities (less than 1000 km apart) which are presumed to have been rain forests at the time of collecting.
Molecular data.
Two paratype male specimens rendered partial barcodes (361 bp for the one with DNA voucher code CNCHYM 03387, and 164 bp for the one with DNA voucher code CNCHYM 07145). The nucleotide sequence shown below corresponds to the longer sequence in the barcode region of COI:
TAAGATTTTGATTATTAATTCCATCTTTATTTATATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGTACAGGTTGAACAGTATACCCACCATTATCATCAAATTTAAGACATAGGGGCATATCAGTCGATTTAAGAATTTTTTCTTTACATTTAGCAGGAACTTCATCAATTATAGGAGCAATTAATTTTATTACAACAATTAAAAATATACGAGTTAAATTATTTAAAATAAATAAAATTTCTTTATTTAATTGATCAGTTTTAATTACAGCAATTTTATTATTATTATCATTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTT
Etymology.
This species is dedicated to Tanya Heckmann Dapkey of Philadelphia, Pennsylvania, USA, in recognition of her seven years of diligent and highly accurate sorting, processing, databasing, and de-legging ACG microgastrine wasps for DNA barcoding.
Comments.
The biology of this species, collected with Malaise traps, is unknown. In the CNC collection there are two additional specimens of Mariapan teles from Brazil: one female from Piedra Azul, Minas Gerais; and one male from Rio Javari, Estirar do Equador, Amazonas. Both specimens differ morphologically from Mariapanteles dapkeyae . Additionally, the male specimen (with DNA voucher code CNCHYM 03380) rendered a partial DNA barcode (164bp) which has 7 base pairs different (4.3 %) from the barcoded specimens of Mariapanteles dapkeyae . We believe those two specimens may represent additional species, but because they are singletons we have not described them as new species here.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
