Catocyclotis luteonaevia, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 6-8

Catocyclotis luteonaevia Grishin, new species

http://zoobank.org/ 5B5C4D82-4ECB-49D1-8546-08AC223A0C4C

( Figs. 1 part, 5) Definition and diagnosis. Genomic phylogeny of Catocyclotis Stichel, 1911 (type species Hesperia aemulius Fabricius, 1793 ) reveals that a specimen from Bolivia curated in MFNB as a type of Echenais

Catocyclotis zerna (Hewitson, 1872) (type locality in Brazil: Rio de Janeiro ) at the species level ( Fig. 1), e.g., their COI barcodes differ by 6.5% (43 bp). Furthermore, this specimen possesses a unique mitogenome ( Fig. 1c), which rejects Hall's (2018) hypothesis that it is a hybrid and strongly suggests that it is a species distinct from C. zerna and others. The name luteonaevia was introduced by Stichel (1911) as “Forma ♀ luteonaevia , form. nov.” thus proposed for a female form and is infrasubspecific. According to the Glossary of the ICZN Code (1999), an infrasubspecific name is “a name applied to an infrasubspecific entity.” The infrasubspecific entity is defined in part as “specimen(s) within a species differing from other specimens in consequence of intrapopulational variability (e.g. opposite sexes …,” which is what “Forma ♀ ” refers to. To further substantiate this conclusion, we note that Stichel (1911) explicitly proposed new subspecies as “subsp. nov.” in this work, in contrast to the names for infrasubspecific entities. The name luteonaevia was proposed as infrasubspecific and was not adopted as the valid name for a species or a subspecies before 1985 (Art. 45.6.4), being treated as a “form” and in synonymy. Therefore, the name is unavailable, and its “ type ” specimen represents a new species. This new species is differentiated from others by the characters given in Stichel (1911:338) and elaborated by Hall (2018: 295) for Echenais zerna f. luteonaevia . In brief, a female (male unknown) differs from its relatives by an orange-brown marginal band on the dorsal forewing, similar orange overscaling over the dorsal wing surface, and three prominent stretches of white scales in the forewing fringe. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne191.3.1:A117G, cne3560.2.4:T70C, cne 1941.1.6: G93C, cne21329.5.1:A372C, cne5807.3.16:A177G, cne 1302.6.1:T490T (not C), cne38112.1.3:G345G (not A), cne13807.3.1:C1254C (not T), cne1425.14.2:G637G (not T), cne1425.14.2:T648T (not G), and COI barcode: A76G, T118C, G506A, T508C, T574C, T640C.

Barcode sequence of the holotype. Sample NVG-21121A12, GenBank PQ489698, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTTGGAACATCATTAAGTTTATTAATTCGAATAGAATTGGGAACTCCTGGATCTTTAATTGGTGATGATCAAATTTACAACACT ATTGTAACAGCGCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCCGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTACTTCCCCCATCATTATTTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGC TCATGGAGGAACATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCATTATTTATCTGATCTGTAGGTATCACTGCATTATTACTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 5, bears seven labels (3 rd handwritten, others printed with handwritten text in shown italics; 1 st and the last red, others white): [Type], [ Rio Songo (1200 m)| Bolivia (Yungas) | 189 6 —6 Garlepp], [luteonaevia | Stich.], [Coll. | Staudinger], [DNA sample ID: | NVG-21121A12 | c/o Nick V. Grishin ], [ex coll. | H. STICHEL], and [HOLOTYPE ♀ | Catocyclotis | luteonaevia Grishin]. The holotype is missing its abdomen.

Type locality. Bolivia: La Paz Department, Río Zongo , elevation 1200 m .

Etymology. For the stability of nomenclature, the infrasubspecific name proposed by Stichel (1911) is name is given for the yellowish (actually, orange-brown) outer margin of the dorsal hindwing and is a noun in apposition.

Distribution. Currently known only from the holotype collected in western Bolivia.