Bungalotis corentus, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 13-16

Bungalotis corentus Grishin, new species

http://zoobank.org/ C2A91FBA-F127-421D-AADD-E7413CF65DFC

( Figs. 12 part, 13–14)

Definition and diagnosis. Genomic analysis of Bungalotis E. Watson, 1893 (type species Papilio midas Cramer, 1775 ) specimens from western Ecuador reveals that they are sister to Bungalotis corentinus (Plötz, 1882) (type locality in Suriname) but are genetically differentiated from it at the species level ( Fig. 12), e.g., their COI barcodes differ by 1.7% (11 bp), and therefore represent a new species. This new species keys to “ Bungalotis diophorus ” (D.1.2) in Evans (1952), which is a junior objective synonym of B. corentinus , and differs from it by rusty-reddish color of the dorsal side, more red than yellow (is usually yellower in B. corentinus ), larger spots on wings, discal cell spot on the dorsal hindwing is oval, with brown contour, filled with ground color; some postdiscal spots may be paler in the middle; ventral side is browner, spots are larger on the ventral hindwing and filled with more extensive whitish scaling;

harpe is much longer (1.5–2 times of B. corentinus ) and the process of the ampulla is broader ( Fig. 14). Due to unexplored phenotypic variation of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly276665.10.2:A40T, aly349.33.2:A303T, aly349.33.2:A318G, aly666.26.1:C111T, aly3177.6.10:G150A, and COI barcode: A79G, T220C, G316A, T325C, T352C.

Barcode sequence of the holotype. Sample NVG-17104D09, GenBank PQ489702, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGGACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGATTATTACCACCTTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACCGGATGAACAGTATATCCTCCTTTATCCTCAAATATTGC TCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCAATTTTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTT CATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 13 (genitalia in Fig. 14), bears the following seven rectangular labels (4 th handwritten others printed with handwritten text shown in italics), six white: [Alluriquin 700m | PICHINCHA ECUADOR | 11 Sept. ’76 | S. S. Nicolay], [ Bungalotis | clusia ♂ | Det. E. | S.S. Nicolay], [GENITALIA NO. | X-54 45 | J.M.Burns 2003], [ LIKE ACG NOT- | diophorus ♂ USNM], [DNA sample ID: | NVG-17104D09 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 00913870], and one red [HOLOTYPE ♂ | Bungalotis | corentus Grishin] . Paratype: 1♂ NVG-18065C11 Ecuador: Esmeraldas, 500-800 m, Apr-2009, ex coll. M. Büche [EBrockmann] .

Type locality. Ecuador: Pichincha Province, Alluriquín , elevation 700 m.

Etymology. The name is formed from the name of its sister species B. corentinus , made shorter for its new more western relative. The name is treated as a masculine noun in apposition.

Distribution. Currently known only from western Ecuador.

http://zoobank.org/ 18FC50D7-3808-49C3-94B4-A165637BA641

( Figs. 12 part, 15–16)

Definition and diagnosis. Genomic analysis of a specimen from Ecuador superficially similar to Bungalotis astylos (Cramer, 1780) (type locality in Suriname) in having ventrally brown palpi and cheeks reveals that it is sister to Bungalotis milleri H. Freeman, 1977 (type locality in Mexico: Oaxaca), which is a Central American species, but is genetically differentiated from it at the species level ( Fig. 12), thus representing a new species. In mitochondrial DNA, the three species ( B. milleri , B. astylos , and the new one) are not strongly differentiated from each other, although in our tree, the new species is sister to both B. milleri and B. astylos . The new species keys (incompletely) to Bungalotis astylos (D.1.4) in Evans (1952) and is most similar to Bungalotis milleri , with the description by Freeman (1977) applicable to the male of the new species, except as stated below. In contrast to B. milleri (see Freeman 1977), the new species possesses a ray of shiny-blue scales by the costa of the dorsal hindwing ( Fig. 15 bottom) characteristic of B. astylos , Bungalotis midas (Cramer, 1775) (type locality in Suriname), and Bungalotis aureus Austin, 2008 (type locality in Ecuador), and shares with B. astylos ventrally tawny-brown palpi and cheeks (except some white scales along the cheeks’ posterior). The new species differs from B. milleri and B. astylos by being darker and having browner ground color; in particular, the yellow area in the posterior part of the ventral forewing is smaller, does not reach past the postdiscal spots and vein CuA 1, and is more clearly separated from brown ground color. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly6841.81.1:C454T, aly6841.81.1:G498A, aly1139.51.7:T43G, aly2284.27.1:T39A, aly2284.27.1:G44A, aly 2954.3.1:A771A (not C), aly 1409.11.16: C73C (not T), aly2101.22.3:C114C (not G), aly2101.22.3:C117C (not T), aly398.2.3:C66C (not T), and COI barcode: T133C, T340C, A622A, T646C (the barcode may not offer reliable identification on a larger sample of specimens).

Barcode sequence of the holotype. Sample NVG-17103H06, GenBank PQ489703, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAACATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCACCATTATCTACTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCAATCTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTT CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 15 (genitalia in Fig. 16), bears the following six rectangular labels (2 nd and 3 rd handwritten, others printed with handwritten text shown in italics), five white: [ ECUADOR: Pichincha | Tinalandia, 600m, 16km | E Santo Domingo de los | Colorados 18–22 Apr '90 | leg. Brian Harris], [ Bungalotis | midas], [Collected at | mercury | vapor light!], [DNA sample ID: | NVG-17103H06 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23116D05 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 00913817], and one red [HOLOTYPE ♂ | Bungalotis | amydros Grishin]. The first DNA sample refers to the extraction from a leg, and the second is from the abdomen prior to genitalia dissection.

Type locality. Ecuador: Pichincha Province, 16 km east of Santo Domingo, Tinalandia , elevation 600 m.

Etymology. In Greek, aμυδρός (amydros) means dim or faint and refers to reduced orange areas in this species compared to its relatives. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in the western slopes of the Andes in northern Ecuador.