Synargis maxidifa, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 10

Synargis maxidifa Grishin, new species

http://zoobank.org/ 5A2CCC55-4575-451F-9A5E-8CB2A1EE668E ( Figs. 8 part, 9a)

Definition and diagnosis. Genomic analysis reveals that a specimen from northern Peru unique in its wing pattern ( Fig. 9a) belongs to the Synargis regulus group but is genetically differentiated from others at the species level ( Fig. 8), e.g., its COI barcode differs from closer relatives such as Synargis latidifa Grishin, 2024 (type locality in French Guiana) and Synargis tenebritorna Grishin, 2024 (type locality in Brazil: Bahia) by 2.6% (17 bp), and, therefore, represents a new species. This new species is somewhat intermediate in appearance between typical S. regulus group representatives and Synargis chaonia (Hewitson, [1853]) (type locality in Brazil: Amazonas), and differs from its relatives by much broader (more than 5 times) discal yellow band compared to the submarginal band, mostly due to the submarginal band being narrower than in other species, and by slightly paler yellow color compared to S. latidifa . The new species is also similar to Synargis sylvarum (H. Bates, 1867) (type locality in Brazil: Pará), which we have not sequenced. However, in S. sylvarum , the two submarginal spots are connected into a band on the ventral forewing (separated in the new species), dorsal hindwing submarginal band is longer, nearly reaching costal and inner margins (widely separated from the costal margin in the new species), veins on the ventral side of wings are yellower (of the same brown ground color in the new species), and the forewing central spot-like band narrows anteriad, more triangular in shape (rectangular to oval in the new species). This new species is not cryptic and is recognizable by its wing pattern. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: cne14967.2.1:C384A, cne14967.2.1: C387T, cne14967.2.1:A396G, cne14967.2.1:C399T, cne14967.2.1:C405T, cne349.3.6:C84C (not T), cne349.3.6:C90C (not T), cne349.3.6:G117G (not C), cne40.6.1:T711T (not G), cne40.6.1:G717G (not T), and COI barcode: A316T, C391C, T442C, T463C, A494T, T464C.

Barcode sequence of the holotype. Sample NVG-23103C10, GenBank PQ489700, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTACTAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATCTTAGGTGCAATTAACTTTATTACTACTATTATTAACATACGTATTAATAATTTATCA TTTGATCAATTACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCGGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the Senckenberg Naturmuseum , Frankfurt, Germany ( SMF), illustrated in Fig. 9a, bears the following three rectangular labels (1 st handwritten, others printed), two white: [Pumayacú | Sept · 1933], [DNA sample ID: | NVG-23103C10 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Synargis | maxidifa Grishin].

Type locality. Peru: Loreto Region, Pumayacu .

Etymology. The name is given for the large difference in widths of the discal (very broad) and submarginal (narrow) bands, compared to its relative S. latidifa , where the difference is notable: maxi [ma]+ dif [ferenti] a, i.e., maximal difference in Latin. The name is treated as an adjective.

Distribution. Currently known only from the holotype collected in the Loreto Region, northeastern Peru.