Synargis gohia, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 8

Synargis gohia Grishin, new species

http://zoobank.org/ 2E0150FE-9303-4BA0-86A3-D642712A4E2C ( Figs. 6 part, 7d–f)

Definition and diagnosis. Genomic analysis of additional specimens in the Synargis regulus group reveals a clade from Brazil (Bahia and Goiás) ( Fig. 6 red) representing a taxon most closely related to Synargis regina Grishin, 2024 (type locality in Peru) ( Fig. 6 blue) and Synargis reginella Grishin, 2024 (type locality in Brazil: Pará) ( Fig. 6 green), but distinct from them both at the species level ( Fig. 6), e.g., its COI barcodes differ from those of S. regina and S. reginella by 2% (13 bp) and 2.4% (16 bp), respectively. This new species is most similar to S. regina and S. reginella and differs by less extensive than in S. reginella but more extensive than in S. regina yellow spotting along the outer margin of ventral hindwing, somewhat broader brown bands between yellow areas, and longer than in S. reginella postdiscal yellow area along the inner margin of hindwing as a result of wider separation between the brown bands towards the inner margin. Males are yellower and less orange than S. reginella , with abdomen brown above and pale-yellow beneath (males of S. regina are unknown). Females of the new species we sequenced are smaller in size than either S. regina or S. reginella ( Fig. 7). However, the male is comparable to males of S. reginella , and, therefore, the difference in size may be individual variation. Due to unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne6558.13.3:A1623C, cne6558.13.3:C1632T, cne12987.3.24:G2562T, cne12987.3.24:T2565G, cne12987.3.24:T2568G, and COI barcode: C81C, T274T, T283C, T334T, T479C, T514C.

Barcode sequence of the holotype. Sample NVG-23103C07, GenBank PQ489699, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGGTTCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTCTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGC TCACAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACTACTATTATTAATATACGTATTAATAATCTATCA TTTGATCAAATACCTTTATTTATTTGATCCGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGATCCCGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ currently deposited in the Senckenberg Naturmuseum, Frankfurt, Germany ( SMF), illustrated in Fig. 7e, bears the following three printed rectangular labels, two white: [ Rio Preto | März 1927 | Dr. Seitz leg.], [DNA sample ID: | NVG-23103C07 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Synargis | gohia Grishin]. Paratypes: 1♂ and 1♀ from Brazil in SMF: 1♂ NVG-23103C08 Goias, Viannepolla, Nov-1921, Coll. R. Spitz and 1♀ NVG-23103C09 data as the holotype.

Type locality. Brazil: Bahia, Preto River .

Etymology. The name is a fusion of the names of states where this species has been recorded from: Go [iás] + [Ba] hia. Furthermore, goia means joy in Guaraní, fitting the appearance of this joyful species. The name is treated as a noun in apposition.

Distribution. Currently known from central and northeastern Brazil, the states of Goiás and Bahia.