Pellicia ( Mictris ) rio, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/E87A9B1F-9A6F-851A-FE34-2CD366BC9789 |
|
treatment provided by |
Felipe |
|
scientific name |
Pellicia ( Mictris ) rio |
| status |
new species |
Pellicia ( Mictris) rio Grishin, new species
http://zoobank.org/ 83EF1B93-BD7C-4CB3-A2F3-82E783A8E1E6 ( Figs. 24 part, 25, 26a–c)
Definition and diagnosis. Genomic analysis reveals that a specimen from Southeast Brazil identified as Pellicia ( Mictris) cambyses (Hewitson, 1878) ( type locality in Bolivia) is genetically differentiated from it at the species level ( Fig. 24), e.g., their COI barcodes differ by 2.1% (14 bp), and therefore represents a new species. This new species keys to “ Mycteris crispus crispus ” (E.15.(b)) in Evans (1953) and was included in this taxon. It differs from its relatives by a combination of the following characters: the hindwing beneath is paler in the posterior half but without the glittering overscaling of Pellicia crispus Herrich-Schäffer, 1870 ( type locality in Venezuela), and paler areas are broader than in a typical P. cambyses , including paler area right at the forewing tornus beneath; a postdiscal band of glittering spots on the dorsal hindwing is closer to the outer wing margin towards apex than in P. cambyses , in which the band bends stronger towards the base between the vein CuA 1 and the costal margin; harpes are less robust, shorter, and stronger curved dorsad ( Fig. 26a–c) than in P. cambyses , in which the left harpe is distally expanded and the right harpe is narrower ( Fig. 26d–f), and the spiculose expansion on the right ampulla is not curving inward dorsally at its base as in P. cambyses ( Fig. 26c, f). Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2275.10.10:C144T, aly 1454.4.1:T222C, aly 1454.4.1:A237T, aly 1454.4.1:A267G, aly 1454.4.1:A270G, aly279231.1.1:C117C (not T), aly13198.5.4: C48C (not T), aly3312.1.2:A189A (not G), aly 1454.4.1:C261C (not A), aly164.12.1:T2079T (not C), and COI barcode: G82A, T124C, A127T, T145C, T407C, T499C.
Barcode sequence of the holotype. Sample NVG-18059D10, GenBank PQ489707, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTACTTATTCGATCTGAATTAGGTACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGATTATTACCCCCCTCTCTTACATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGTTGGAACAGGTTGAACAGTTTATCCCCCTTTATCTGCTAATATTGC TCACCAAGGTTCTTCAGTTGATTTAGCTATTTTCTCTTTACATCTAGCAGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATTA TTTGATCAAATACCCTTATTCATTTGAGCAGTAGGAATTACAGCTTTACTTCTATTATTATCCCTTCCAGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGTAATTTAAATACAT CTTTTTTTGACCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 25 (genitalia in Fig. 26a–c), bears the following seven rectangular labels (2 nd handwritten, others printed), six white: [Petropolis, | Brazil.], [ Mycteris | cambyses | Hew | fide Godm], [Collection | W.Schaus], [GENITALIA NO. | X-57 77 | J.M.Burns 2004], [DNA sample ID: | NVG-18059D10 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01466804], and one red [ HOLOTYPE ♂ | Pellicia (Mictris) | rio Grishin].
Type locality. Brazil: Rio de Janeiro, Petropolis .
a noun in apposition.
Distribution. Currently known only from the holotype collected in Southeast Brazil.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
