Mycteris caerula Mabille, 1877
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/E87A9B1F-9A6C-8514-FE91-299460A1950A |
|
treatment provided by |
Felipe |
|
scientific name |
Mycteris caerula Mabille, 1877 |
| status |
|
Mycteris caerula Mabille, 1877 View in CoL is a junior subjective synonym of Pellicia ( Mictris) crispus Herrich-Schäffer, 1870
Genomic analysis of a syntype of Pellicia crispus Herrich-Schäffer, 1870 (type locality in Venezuela, sequenced as NVG-15032D09) places it among specimens with metallic-blue posterior third of ventral hindwing (not pale brown with violet sheen) and therefore identified as Pellicia ( Mictris) crispus caerula (Mabille, 1877) (type locality in Colombia) ( Fig. 24). A more careful inspection of the syntype reveals the metallic-blue hindwing pattern, although both hindwings are folded inward to cover most of it. Therefore, the syntype of P. crispus is genetically and phenotypically similar to P. crispus caerula and not to specimens traditionally associated with the name P. crispus crispus , and thus is conspecific with the former and not with the latter.
This syntype is the only one we were able to locate, but it agrees with the original description (Herrich-Schäffer 1870), comes from Herrich-Schäffer’s collection, and bears an identification label in Herrich-Schäffer’s handwriting “crispus m”, where ‘m’ stands for ‘mihi’ (Latin for ‘of me’), placed after a species name as an attribution of the new species to the writer. This notation was common over a century ago, instead of the author’s name being written directly. This ‘m’ corroborates that the label was written by Herrich-Schäffer and offers additional evidence that this specimen is a syntype. Furthermore, the original description of P. crispus specifically mentions the shiny blue colors on the ventral hindwing, translated as “beneath dark reddish brown with a violet shimmer, especially on the inner margin half of all wings.” Furthermore, Godman’s (1907) copy (in BMNH) of Plötz’s drawing t[afel]. 204, most likely depicting Herrich-Schäffer’s syntype of P. crispus , shows the posterior half of the ventral hindwing violet-blue, not brownish with bands and spots. Finally, the illustration of P. crispus in Draudt (1921– 1924), which is possibly a copy of Plötz’s unpublished drawing, also shows a violet-blue tornal section of the ventral hindwing, not brown. For all these reasons, we conclude that we found and sequenced a true syntype of P. crispus and propose that Mycteris caerula Mabille, 1877 , syn. nov. is a junior subjective synonym of Pellicia ( Mictris) crispus Herrich-Schäffer, 1870 .
To stabilize nomenclature and define the name P. crispus objectively, N. V.G. hereby designates a syntype in the MFNB collection that bears the following seven labels (1 st purple, others white; 2 nd, 4 th,
H.—Sch | Venezuela], [ Mycteris | Crispa | HS.], [Crispus | H-Sch.], [{QR Code} http://coll. mfn-berlin.de/u/ | 940b8c], [DNA sample ID: | NVG-15032D09 | c/o Nick V. Grishin ] as the lectotype of Pellicia crispus Herrich-Schäffer, 1870 . The 2nd and the 4th labels are in Herrich-Schäffer’s and Staudinger’s handwriting, respectively. The word “ Venezuela ” on the 3rd label is in the handwriting of the 5th label and, therefore, was probably added later during subsequent curation of the collection. The lectotype has the right hindwing with a segment at the outer margin torn away, and both hindwings are partly folded at the tornus and inner margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website ( Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG-15032D09, GenBank PQ489706, 658 base pairs is: AACTTTATACTTTATCTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTACTTATTCGATCTGAATTAGGTACGCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTCGGAAATTGATTAGTGCCTCTTATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCTCTTACATTACTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTTTATCTGCTAATATTGC CCATCAAGGTTCTTCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATCAATATACGAATTAATAAATTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCTCTTCCAGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGTAATTTAAATACAT CTTTTTTCGACCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
| V |
Royal British Columbia Museum - Herbarium |
| MFNB |
Museo Friulano di Storia Naturale |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
