Salatis minimaculatis, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 17-18

Salatis minimaculatis Grishin, new species

http://zoobank.org/ 8789C473-7A6E-4E19-8D3F-3D929CD940D8

( Figs. 17 part, 18–19)

Definition and diagnosis. Genomic analysis of Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782 ) specimens from Loreto Region in Peru reveals that while being sister to Salatis salatis (Stoll, 1782)

(type locality in Suriname), they are most strongly differentiated genetically from it ( Fig. 17), i.e.,

their COI barcodes differ by 4.4% (29 bp).

Therefore, these specimens represent a distinct species that is new because taxa treated as junior subjective synonyms of S. salatis , i.e., Eudamus gonatas Hewitson, 1867 (type locality in Brazil:

Pará, Tapajós) and Telegonus ophiuchus Plötz ,

1882 (type locality in Suriname) are phenotypically different from it in having larger spots in both sexes. This new species keys to Salatis salatis

(D.2.2) in Evans (1952) and differs from it by smaller spots in both sexes: the male is mostly rusty-orange, with only small brown spots, not pupillated with pale scales (except some larger spots on the ventral hindwing), and the female is with much smaller hyaline spots, especially the spot in the forewing discal cell is much reduced and is the smallest of all forewing spots, divided into three: the upper one is brown, the central is pupillated with a tiny hyaline dot, and the lowest is larger and mostly hyaline. Due to unexplored phenotypic variation, it is unclear whether these phenotypic characters will hold in all specimens.

While we expect the specimens of this species to be mostly less patterned than S. salatis , mainly due to consistently reduced spotting in both male and female of the type series, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly1379.16.2:C96 T , aly536.13.6:A162G, aly536.13.6:G183A, aly 2178.10.1:G45A, aly 2178.10.1: T109 A, and COI barcode: T25 C, C50 T, T127 C, A217G, A268G, T277 C.

Barcode sequence of the holotype. Sample NVG-18101G08, GenBank PQ489704, 658 base pairs: AACATTATATTTTATTTTTGGAATCTGAAGAGGTATATTAGGAACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTCACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTGCCCCCTTCCTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCTCCTTTATCTGCTAATATTGC TCACCAGGGATCTTCTGTTGATTTAGCAATTTTCTCCCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCT TTTGACCAAATACCATTATTCATTTGAGCTGTTGGAATTACAGCAATTTTATTATTAATTTCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACTT CATTTTTTGATCCTGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTC

Type material. Holotype: ♂ deposited in the American Museum of Natural History , New York, NY, USA ( AMNH), illustrated in Fig. 18a, bears the following four rectangular labels (1 st handwritten, others printed), three white: [Yurimaguas | Huallaye River | Peru], [G819] (this is its genitalia slide number), [DNA sample ID: | NVG-18101G08 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♂ | Salatis | minimaculatis Grishin]. The genitalia slide has not been located and will be illustrated when found . Paratype: 1♀: NVG-17103G10 (leg sample), NVG-23125F08 (abdomen extraction followed by genitalia dissection) Peru, Loreto Region, 50 mi E of Iquitos, Amazon River, Explorama Lodge , 200 m, 12-16-Sep- 1990, Ron Leuschner leg. [ USNM] ( Fig. 18b, genitalia in Fig. 19) .

Type locality. Peru: Loreto Region, Yurimaguas, Huallaga River .

Etymology. In Latin, minimus means smallest or least significant, and maculatis means spotted or stained. The name is given for the reduced spotting in both sexes of this species and is the perfect passive participle in the nominative singular.

Distribution. Currently known only from the Loreto Region in northeastern Peru.