Perus (Menuda) tinctus, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 28-31

Perus (Menuda) tinctus Grishin, new species

http://zoobank.org/ B3612B03-2C13-467B-A3D5-EBBCFBD2180F

( Figs. 32 part, 33)

Definition and diagnosis. Genomic sequencing of a specimen curated in MFNB as “Origin.” of the name “ Antigonus vulgata HS ” (either unpublished or published with misattributed authorship and misidentified, see comment below) reveals that it is related to Perus menuda (Weeks, 1902) (type locality in Bolivia, syntypes sequenced as NVG-19055F05, 06, and 07), but is genetically differentiated from it at the species level ( Fig. 32), e.g., their COI barcodes differ by 5.4% (35 bp). Therefore, this specimen represents a new species. This new species keys to “ Staphylus menuda ” (E.32.16) in Evans (1953), and might have been included in it (Evans’ female from Rio de Janeiro , Brazil: “unh tornally with whitish scaling”), but differs from true P. menuda by the tornal area of the ventral hindwing overscaled with cream-colored scales and more prominent cream spots overall. Differs from other relatives by a combination of rounded (not scalloped) at margin wings with brown fringes, brown head above (with some cream overscaling, but not orange or green), costal fold in males, the lack of forewing apical spots, a well-defined row of pale spots in the submarginal area of all wings above (weakly expressed on the ventral hindwing as well), diffuse paler spot at the end of the discal cell of the dorsal forewing, a pale bar at the end of the discal cell, and oval discal spots in cells CuA 1 -CuA 2 and CuA 2 -1A+2A (the latter being the largest) on both sides of hindwings. The holotype (the only known specimen) lacks an abdomen; thus, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly10226.6.1:C228T, aly3109.11.2:A177G, aly 2844.9.2:A54G, aly1313.29.3:A60T, aly 1139.2.13:A69C, aly3109.11.2:T171T (not C), aly536.39.4:G207G (not A), aly490.12.1:A3342A (not G), aly5021.7.12:T843T (not C), aly5021.7.12:C902C (not T), and COI barcode: T10T, T142C, T157C, A217G, T421C, T478C.

Barcode sequence of the holotype. Sample NVG-21117C03, GenBank PQ489710, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGATCAGGTATAGTAGGTACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGAATCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTCATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCTCTTATATTAGGGGCCCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTCATACTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGTACTGGATGAACTGTCTATCCCCCTCTTTCAGCCAATATTGC CCATCAAGGTTCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCTTTACTTTTATTACTATCTTTACCAGTTTTAGCTGGGGCCATTACCATACTCCTAACAGATCGAAATCTTAATACTT CTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 33, bears the following nine rectangular labels (1 st purple, last red, others white; 2 nd, 4 th, and 6 th handwritten, others printed): [Origin.], [ Ant. vulgata | ĉ HS], [Coll. H.—Sch.], [Antig. | vulgata | HS.], [Coll. | Staudinger], [type | von?], [{QR Code} http://coll.mfn-berlin.de/u/ | 908615], [DNA sample ID: | NVG-21117C03 | c/o Nick V. Grishin ], and [HOLOTYPE ♂ | Perus (Menuda) | tinctus Grishin]. The abdomen is missing in the holotype.

Type locality. South America , as deduced by the range of related species, otherwise unknown, possibly Southeast Brazil .

Etymology. In Latin, tinctus means stained, dyed, tinged, tinted, or colored. The name is given for the cream overscaling towards the tornus of the ventral hindwing, which is not expressed in its sister species. The name is a participle.

Distribution. Currently known only from the holotype likely collected in South America, possibly in Southeast Brazil.

Comments. The holotype of this new species, a specimen originally from Herrich-Schäffer’s collection, is most probably a specimen that Plötz intended to use in his description of a species he planned to name “ vulgata .” Plötz effectively published this name in 1884 ( Plötz 1884), but after Möschler had already described Achlyodes vulgata Möschler, 1878 (type locality in Colombia), currently a valid species of Staphylus Godman & Salvin, 1896 (type species Helias ascalaphus Staudinger, 1875 ). Plötz explicitly referenced A. vulgata Möschler in his 1884 description of vulgata . Therefore, vulgata , as published by Plötz in 1884, is not a new species (or a replacement name—the name is the same), even if it was Plötz’s original intention, and the specimens he used for this description, other than Möschler's two syntypes of unpublished t[afel]. 958 because it agrees with his description of A. vulgata and is curated as a type of “vulgata ” but is not a syntype of A. vulgata Möschler, 1879 . Both syntypes (male and female) of A. vulgata Möschler, 1879 are extant, and this is a third specimen. The locality “ Colombia ” in the original description likely referred to Möschler’s publication (1879) referenced by Plötz after his name “vulgata Pl ” ( Plötz 1884) because Herrich-Schäffer’s “vulgata ” specimen lacks a locality label. We consider Plötz’s Achlyodes vulgata a misattribution and misidentification of Achlyodes vulgata Möschler, 1879 , assuming that “Pl” after the name resulted from some mistake. “Pl” might have been “inherited” from an earlier version of the manuscript prepared before the availability of Möschler's vulgata , and it should have been “Mösch” instead. In any interpretation of “vulgata Pl ”, the name vulgata cannot be used as valid for this specimen.

A specimen in MFNB curated as a type of Achlyodes serapion Plötz, 1884 is a pseudotype

A single specimen that, according to its label, was identified by Plötz as “serapion ” (“best[immt]. v[on]. Plötz”) is placed under the handwritten on blue-green paper header label “serapion | Plötz” with a red handwritten label “Typus” pinned next to it. This specimen was photographed by Bernard Hermier; photographs shown on the Butterflies of America website ( Warren et al. 2024). It is a worn specimen, which, judging from its labels, was originally from the Weymer collection, collected in Central America in 1876. Its phenotype and locality do not agree with the original description of Achlyodes serapion Plötz, 1884 (type locality Brazil: Rio de Janeiro , Nova Friburgo). Moreover, no “i. l.” (for in litteris, referring to unpublished names) was added to the name on the identification label of this specimen. The “i. l.” is typical of Plötz’s type specimens in the Weymer collection that Plötz identified before his publication. For instance, lectotypes of Pyrgus (Pyrgus) albescens Plötz, 1884 (type locality in Mexico), currently Burnsius communis albescens , and Hesperia erratica Plötz, 1883 (type locality in the USA as deduced by genomic sequencing, not Guatemala as on the specimen label and in the publication), currently a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]) , have “i. l.” on their labels. Another label includes the number of Plötz’s unpublished drawing, e.g., “taf. 889” for P. albescens and “taf. 656” for H. erratica . No mention of Plotz’s taf[el]. number was on the labels of the “serapion ” specimen. Moreover, its identification label has both localities: “N Freyburg.” and “Amer centr.” The latter was possibly added later and agrees with the same statement on the locality/date/collector label, and the former likely refers to the locality given in the publication ( Plötz 1884).

To learn more about this putative “serapion ” specimen, it was sampled for DNA and sequenced as NVG-15032H01. The genomic analysis identified it as Staphylus (Scantilla) opites Godman & Salvin, 1896 (type locality in Guatemala) ( Fig. 34 magenta within green), a species known only from Mexico and Central America. Therefore, the “Amer centr.” locality given on the locality/date/collector label should be correct, but “N Freyburg.” on the identification label simply states the type locality of A. serapion . We conclude that the specimen NVG-15032H01 is not a syntype of Achlyodes serapion Plötz, 1884 , because it does not closely agree with the original description and is from Central America, instead of being from the type locality in Brazil. It was probably identified by Plötz as A. serapion after this name was dorsal hindwing, this species does not agree with the original description of A. serapion , the specimen NVG-15032H01 was misidentified by Plötz, possibly after the description of A. serapion .

Future studies will shed light on the true identity of A. serapion . It is possible that Evans (1953) was correct, and the discovery of a male conspecific with the specimens Evans identified as A. serapion should be able to address this question. Another twist to this puzzle is offered by a specimen in MFNB (sequenced as NVG-15032E04) curated as a syntype of Pellicia licisca Plötz, 1882 (type locality in Nicaragua). Although, according to its label, it was identified as P. licisca by Plötz, this specimen agrees neither with the original description nor the type locality (labeled from Brazil, not Nicaragua) of P. licisca . This specimen, identified by us as Viola minor (Hayward, 1933) (type locality in Argentina, also known from SE and S Brazil), agrees reasonably well with Godman’s copy of the unpublished drawing of A. serapion . What if, due to some label mix-up, this specimen is a syntype of A. serapion? If this was not for Evans’ choice, which may be fitting Plötz’s illustration better (if a male of that species has mostly brown ventral hindwing darker towards the base), out of all Hesperiidae known to us, V. minor may indeed be in the best agreement with all information we have about A. serapion .