Timochares fuscifasciata, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 39-41

Timochares fuscifasciata Grishin, new species

http://zoobank.org/ 77C3A246-2F3A-465B-8091-42AB7491A0C5

( Figs. 39a, 40 part, 42–43)

Definition and diagnosis. As discussed above, Evans (1953) misidentified Timochares ruptifasciata ( Plötz, 1884) (type locality in Jamaica) and misapplied this name to continental populations related to Jamaican T. ruptifasciata . These continental populations are genetically differentiated from T. ruptifasciata at the species level ( Fig. 40), e.g., their COI barcodes differ by 3.6% (24 bp), thus confirming phenotypic assessment of Austin and Warren (2002). Because no available name applies to this species, it is new. This new species keys to “ Timochares ruptifasciata ruptifasciata ” (F.5.2(a)) in Evans (1953) and was regarded as this taxon by him due to misidentification. Therefore, Evans’ key directly applies to this species, with additional comments on the identification by Austin and Warren (2002) (under the name T. ruptifasciata ) who illustrated its genitalia. In summary, the new species differs from its relatives by the following combination of characters: pale yellowish-brown (frequently tan) wings with irregular brown bands separated into spots (bands are less irregular than in T. ruptifasciata ); compared to T. ruptifasciata , the spots are more interconnected and less contrasting with the ground color, dorsal hindwing is usually with a yellower than redder tint, and ventral side of wings is yellow-tan rather than red-tan. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly5196.11.5:A1762T, aly5196.11.5:G1789A, aly5196.11.5:T1848C, aly16.16.5:C72G, aly16. 16.5:A99T, and COI barcode: A91C, C340T, A466G, T490C, T589C, A622G.

Barcode sequence of a paratype. Sample NVG-17116A12, GenBank PQ489712, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGGGCAGGAATAGTTGGAACTTCTCTAAGTCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCCTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTATCCCCCCCTTTCAGCTAATATTGC ACATCAAGGTTCTTCTGTAGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATTTCCTCAATTCTTGGAGCAATTAACTTTATTACAACAATTATTAATATGCGAATTAGAAATTTATCT TTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACAGCATTACTTTTGTTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGACCGAAATCTTAATACAT CATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the

Texas A&M University Insect Collection, College

Station, TX, USA ( TAMU), illustrated in Fig. 42,

bears the following five printed (text in italics handwritten) rectangular labels, four white:

[TEXAS: | HIDALGO COUNTY, | Santa Ana National

| Wildlife Refuge], [ex larva | 7 FEB 19 72 | Roy

O. Kendall | & C. A. Kendall], [Larval foodplant:

| MALPIGHIACEAE | Malpighia glabra | Linnaeus |

(Juvenile fol./b. buds)], [ HESPERIIDAE , | Pyrginae :

| Timochares ruptifas- | ciatus ruptifasciatus |

( Plotz, 1884) | ♀ det. R. O. Kendall | [M. & B. No.

79]], and one red [HOLOTYPE ♀ | Timochares |

fuscifasciata Grishin]. A female is chosen as the holotype, the same sex as the lectotypes of T.

trifasciata and T. ruptifasciata . Paratypes: 6♂♂

and 6♀♀: USA: 1♀ NVG-18032B02, USNMENT _

01201760 Arizona, Pima Co., Baboquivari Mts .,

1924, O. C. Poling leg. [ USNM] and Texas: 1♀

NVG-17116A12 Bexar Co., San Antonio, 17-Jul-

1997, Roy O. Kendall leg., ex larva on Malpighia glabra [ TAMU]; Hidalgo Co.: 1♀ NVG-23074A11 ,

Peñitas, 4-Nov-2004, N. V . Grishin leg. [ NVG];

1♂ NVG-18032B01, USNMENT_01201758 Bentsen-Rio Grande Valley State Park, 18-Oct-1975 E.

C. Knudson leg. [ USNM]; Mission, 10 th Street at irrigation ditch , Roy O. Kendall & C. A. Kendall leg. [ TAMU]: 1♂ 9-Sep-1972 and 1♀ 8-Sep-1972,

genitalia vials NVG130104-15 and NVG130104- 14 , respectively; and 1♀ McAllen, Vanecia Motel ,

22-Oct-1972, Roy O. Kendall & C. A. Kendall leg., ex larva on Malpighia glabra [ TAMU] and Cameron Co., Brownsville : 1♂ NVG-23124H07, USNMENT_01201759 13-May-1945, H. A. Freeman leg.

[ TAMU]; Mexico: 1♀ Tamaulipas, Paso del Abra, near El Abra , 1-Apr-1974, Roy O. Kendall & C. A. Kendall leg., ex larva on Malpighia glabra [ TAMU] and 1♂ NVG-19113B11, USNMENT_01602123 Sinaloa, Culiacán, 8-Jul-1957, G. W. Rawson leg. [ USNM]; and 1♂ NVG-18093A10 Honduras: San Pedro Sula, ex. coll. Fruhstorfer, invalid lectotype of Timochares trifasciata form obscurior Draudt, 1923 [ SMF] .

Type locality. USA: Texas, Hidalgo Co., Santa Ana National Wildlife Refuge .

Etymology. In Latin, fuscus is brown, and fascia is a band. The name is a Latin equivalent of “Brown-banded,” the English name of the species found in the USA, present in the lower Rio Grande Valley of Texas in most years and straying to Arizona and New Mexico. The name is an adjective. Spots on wings are more discrete and irregular in the Jamaican species. Therefore, rupti- is in better agreement with Jamaican populations.

Suggested English name. Brown-banded Skipper is the current name for this species, which is misidentified by the Latin name.

Distribution. From southern USA (SE Arizona, SW New Mexico, S Texas) through Mexico to Honduras.

Comments. Primary types are the name bearers and specimens conspecific with the type bear its name. This is one of the basic principles of the ICZN Code (ICZN 1999). As in other similar cases, e.g., Hesperia colorado (Scudder, 1874) (Cong et al. 2021) , Burnsius communis albescens ( Plötz, 1884) ( Zhang et al. 2022a) , and Nastra fusca (Grote & Robinson, 1867) (Zhang et al. 2022c) , we accept the type specimen of T. ruptifasciata as the name bearer instead of attempting to set it aside. Notably, before 2002, when Austin and Warren (2002) proposed to treat Jamaican populations of T. ruptifasciata as a distinct species Timochares runia Evans, 1953 , they were considered conspecific with continental populations.