Sabera kolbei ( Ribbe, 1899 ), 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 46

Telicota kolbei Ribbe, 1899 belongs to the genus Sabera Swinhoe, 1908 and not Mimene Joicey & Talbot, 1917

Genomic analysis of a syntype of Telicota kolbei Ribbe, 1899 (type locality in New Britain, sequenced as NVG-22016H05) reveals that it is not monophyletic with Mimene Joicey & Talbot, 1917 (type species Ismene miltias Kirsch, 1877 ), the genus of its current placement, but instead is sister to Sabera Swinhoe, 1908 (type species Hesperia caesina Hewitson, 1866 ), which is a sister genus of Mimene ( Fig. 44). Therefore, T. kolbei does not belong to Mimene , and we transfer it to Sabera forming Sabera kolbei ( Ribbe, 1899) , comb. nov.

Furthermore, to stabilize nomenclature and define the name T. kolbei objectively, N.V.G. hereby designates a sequenced syntype in ZSMC ( Fig. 47a), female that, according to its label, was illustrated in the original description by Ribbe (1899) and bears the following six rectangular labels (2nd, 3rd, and 5th handwritten, others printed; 2nd green, 4th purple, others white): [Neu Pommern | Kinigunang | C. Ribbe], [abgebildet], [Kolbei | Ribbe | abgebild.], [Original], [♀ Cerone Kolbei Rib. | typ. | N. Pommern], [DNA sample ID: | NVG-22016H05 | c/o Nick V. Grishin ] as the lectotype of Telicota kolbei Ribbe, 1899 . The lectotype has a tear near the base of the forewing costa, is missing the right antenna, and its left antenna is wide-S shaped. The COI barcode sequence of the lectotype, sample NVG-22016H05, GenBank PQ489713, 658 base pairs is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATATTAGGAACTTCCTTAAGTCTATTAATTCGTACCGAATTGGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATACTAGGAGCCCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTTTTAATTTCTAGAAGAATTGTAGAAAACGGTGCCGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC TCATCAAGGTTCCTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAACAATTTATCA TTTGATCAAATACCTCTATTTATTTGATCTGTAGGAATTACAGCATTATTATTATTAATTTCATTACCAGTCTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTCGACCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT