Vistigma (Vistigma) shnoba, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, New taxa of butterflies supported by genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (3), pp. 1-63 : 54-55

Vistigma (Vistigma) shnoba Grishin, new species

http://zoobank.org/ 112EE07F-ADEB-429B-9129-363978D56578

( Figs. 57 part, 58–59)

Definition and diagnosis. Genomic sequencing of a specimen initially identified as Vistigma (Vistigma) opus ( Steinhauser, 2008) (type locality in Guiana) reveals that while being sister to it, it is genetically differentiated from V. opus at the species level ( Fig. 57), e.g., their COI barcodes differ by 1.6% (11 bp), and therefore represents a new species. The description of Thoon opus given by Steinhauser (2008) applies to this new species, except that the forewing discal cell spot is smaller, and there is a dot-like semihyaline spot in R 4 -R 5 cell on the dorsal side, not only ventrally, where the forewing lacks an ocherous streak in Cu 2 -2A cell, and the hindwing has weaker ocherous overscaling, in particular, in the discal cell and along the vestigial vein 1A (but with streaks and overscaling along the veins as in V. opus ). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly728.7.2:C279T, aly 1259.4.2:C180T, aly731.4.9:G51A, aly423.15.6:A132G, aly216.78.1:A528G, aly925.

44.2:C75C (not T), aly728.13.6:A72A (not G), aly1283.20.2:C159C (not T), aly736.5.4:A54A (not G), aly506.10.2:T252T (not C), and COI barcode: T38T, 100G, A211G, T304C, T541T, 607C.

Barcode sequence of the holotype. Sample NVG-19024C05, GenBank PQ489717, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCTTTAAGACTATTAATCCGCACTGAATTAGGAGCTCCAGGATCATTAATTGGGGATGATCAAATTTACAACACT ATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTACCATTAATGCTAGGAGCTCCAGATATAGCTTTCCCTCGAA TAAATAATATAAGATTCTGAATATTGCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCTCTTTCATCTAATATTGC TCATCAAGGAGCATCTGTTGACTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACCGCATTATTATTACTTTTATCCTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACAT CCTTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATCTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 58 (genitalia in Fig. 59), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ PERU 300m | 30 Km S.W. | Pto. Maldonado | 24 Oct. '83 | S. S. Nicolay], [genitalia | ♂ slide/vial # | H882 | Prep. S.S. Nicolay] [DNA sample ID: | NVG-19024C05 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01532913], and one red [HOLOTYPE ♂ | Vistigma (Vistigma) | shnoba Grishin].

Type locality. Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado , elevation 300 m.

Etymology. The name is formed from Yiddish (shnobl) or German Schnabel for beak or nose, given for the shape of uncus that inspired the name opus for its sister species: “because of the resemblance of the lateral view of the uncus and gnathos to the character Opus, the penguin, in the old comic strip” ( Steinhauser 2008). The name is treated as a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in southeastern Peru.